G228698


Basic Information

Item Value
gene id G228698
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 5839825 ~ 5840071 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU259531
CTATTTCCGGTAGATTTTCGAAGTGTGGATCCGTGCACACTATAAAGGCTAATATTGCCCACAACCCATTGCGCTTTGGATGAGGATTCAGTTCAGAACTACAAACACGAGTAAAAAGTGTTAAAAAACTACAAAACATGGCGGATATGCGCGACCGACGCTGAGAGGTTTGAGTGACTAATAATCAGTTCAACCTGATAGAAAATATTTATTTAATGTTATCCGTGTTATATTTCATCTGCAATAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU259531 True 247 lncRNA 0.38 1 5839825 5840071

Neighbor

gene id symbol gene type direction distance location
CI01000053_05796556_05798076 ADRA2B coding upstream 40001 5795873 ~ 5799824 (+)
CI01000053_05784784_05786704 DUSP2 coding upstream 52167 5784266 ~ 5787658 (+)
CI01000053_05764395_05769061 NA coding upstream 70740 5764395 ~ 5769085 (+)
CI01000053_05704944_05710574 GCK, GK coding upstream 128704 5704848 ~ 5711121 (+)
CI01000053_05593016_05597420 ORAI1, ORAI1A coding upstream 242337 5593016 ~ 5597488 (+)
CI01000053_05920285_05920932 NA coding downstream 80022 5920093 ~ 5921020 (+)
CI01000053_05976882_06023460 GPAT2 coding downstream 136811 5976882 ~ 6023691 (+)
CI01000053_06046867_06049295 NA coding downstream 206796 6046867 ~ 6049295 (+)
CI01000053_06050344_06056286 NA coding downstream 210273 6050344 ~ 6056649 (+)
CI01000053_06095365_06103392 OLFML2A coding downstream 255294 6095365 ~ 6104033 (+)
G228439 NA non-coding upstream 76816 5762052 ~ 5763009 (+)
G228436 NA non-coding upstream 82210 5757402 ~ 5757615 (+)
G228425 NA non-coding upstream 101574 5737817 ~ 5738251 (+)
G228360 NA non-coding upstream 110828 5717819 ~ 5728997 (+)
G228699 NA non-coding downstream 148 5840219 ~ 5840433 (+)
G228716 NA non-coding downstream 43394 5883465 ~ 5884938 (+)
G228717 NA non-coding downstream 43547 5883618 ~ 5883878 (+)
G228722 NA non-coding downstream 50483 5890554 ~ 5890942 (+)
G228739 NA non-coding downstream 79414 5919485 ~ 5919756 (+)
CI01000053_05471449_05512831 LRRC75B other upstream 326751 5471449 ~ 5513074 (+)
G228257 NA other upstream 461376 5375553 ~ 5378449 (+)
G227317 NA other upstream 1424232 4414951 ~ 4415593 (+)
G226399 NA other upstream 2142296 3620798 ~ 3697529 (+)
G226347 NA other upstream 2564914 3272374 ~ 3274911 (+)
CI01000053_06725452_06758944 NA other downstream 883128 6725452 ~ 6758944 (+)

Expression


Co-expression Network