G230475


Basic Information

Item Value
gene id G230475
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 2082025 ~ 2082459 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU261571
CTAAATGGGTTGTTATGCGCGTCGTGTCGGCAGCACAAGGCGAGCTTACTACACTGACAGATAAATTGTGGACAGCCATATTAACTCCCTCTTCTTTCCGATCGACTGGAGCATTTTGAGGAACATTGTGGTGCGAAACCGCCGCGATTCCACACAACATTTGGACATTCTTCCAGCCGTTTCCAAAACTTACAGACCAACAAAACAGACTGCACTTTTTCGCAATGACAGATATGTGGTTTTAGAGGCCGCATTGGTGGACTGGAGTGATTTCGTGCGAAATGTCATCTGCCATTGTGTGAAGCACCAAGGGTTAGGAAATGATTTTTAACAAATGCCGAAGGCTATTGTTCAGATCTGGATTATGTTGCAGGGACTGATATTTCTAATGCAGCTATAAATGATACTAATCAAAAAAACAAAAAACAAAGCGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU261571 True 435 lncRNA 0.43 1 2082025 2082459

Neighbor

gene id symbol gene type direction distance location
CI01000054_02024879_02026284 NA coding upstream 54446 2024879 ~ 2027615 (+)
CI01000054_01879983_01965668 TRIO, TRIOA coding upstream 115866 1879983 ~ 1966159 (+)
CI01000054_01871659_01875753 NA coding upstream 205815 1871548 ~ 1876210 (+)
CI01000054_01725792_01726688 NA coding upstream 355285 1725627 ~ 1726793 (+)
CI01000054_01706858_01711137 NA coding upstream 370775 1705732 ~ 1711250 (+)
CI01000054_02096054_02105211 GNRHR1, GNRH-R coding downstream 13595 2096054 ~ 2105265 (+)
CI01000054_02195667_02196307 CHRAC1 coding downstream 113208 2195667 ~ 2196853 (+)
CI01000054_02225261_02226820 DLX5, DLX5A coding downstream 142068 2224527 ~ 2227071 (+)
CI01000054_02239241_02261796 NA coding downstream 155865 2238324 ~ 2261858 (+)
CI01000054_02272856_02274337 SHFM1, SHFM1.S, DSS1 coding downstream 188730 2271189 ~ 2274545 (+)
G230500 NA non-coding upstream 63657 2016274 ~ 2018368 (+)
G230496 NA non-coding upstream 71589 2010002 ~ 2010436 (+)
G230463 NA non-coding upstream 110164 1858188 ~ 1971861 (+)
G230462 NA non-coding upstream 274720 1767423 ~ 1807305 (+)
G230606 NA non-coding downstream 23261 2105720 ~ 2108675 (+)
G230617 NA non-coding downstream 32977 2115436 ~ 2115817 (+)
G230622 NA non-coding downstream 39862 2122321 ~ 2122664 (+)
G230624 NA non-coding downstream 41908 2124367 ~ 2124737 (+)
G230632 NA non-coding downstream 49238 2131697 ~ 2132037 (+)
CI01000054_01650242_01665628 PLEKHO1A other upstream 420460 1650242 ~ 1666115 (+)
CI01000054_01578022_01579167 NA other upstream 499956 1578022 ~ 1579356 (+)
G229936 NA other upstream 674895 1397080 ~ 1407130 (+)
G229760 NA other upstream 808275 1266350 ~ 1273750 (+)
CI01000054_02289802_02330591 SLC25A13 other downstream 207372 2289802 ~ 2330981 (+)
G230689 NA other downstream 996043 3078502 ~ 3087392 (+)
CI01000054_03848427_03914231 NA other downstream 1825992 3848427 ~ 3914231 (+)
G231863 NA other downstream 2324693 4407152 ~ 4450730 (+)
CI01000054_05608892_05634793 RNF19B other downstream 3540556 5608457 ~ 5634804 (+)

Expression


Co-expression Network