RNA id: TCONS_00000204


Basic Information

Item Value
RNA id TCONS_00000204
length 927
RNA type mRNA
GC content 0.57
exon number 4
gene id XLOC_000110
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 9082417 ~ 9091935 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAGGGTGTGTAACCGTGGAGTGCAGATGCTCCTCACCACGGCGGGGGCTTTCGCGGCCTTCAGCCTAATGACCATCGCGGTGGGCACCGATTACTGGCTGTACTCGCGCGGAGTCTGCAGGACCAAGAGCGTCAACGACAACGACACAAACCGCAAGAATGAGGAGGTGCTGACGCATTCAGGACTCTGGAGACAGTGCTGCATGGAAGGCATATTTAAGGGCGTCTGTAAAAACATCGACCATTTTCCAGAGGACGCGGATTATGAACAAGATGCTGCGGAATATCTGTTGCGTGCTGTGCGCGCTTCTAGTCTCTTCCCTATAATGAGTGTGGGTCTGCTGTTCATTGGTGGAGTGTGTGTCGCTGCCAGCGAGTTTTACAAGAGCAGACACAACGTCATCCTCAGCGCTGGGATCTTTTTTGTCTCAGCTGGCCTCAGCAACATCATTGGCATTATTGTGTACATCTCCTCCAGCGCCGGCGACCCCAACCAGAGCGAGTCCAAGCGCAGCCACTGGTACGGCTGGAGCTTCTACTGCGGTGCTCTTTCCTTCATCATAGCGGAGACGGTGGGCGTCCTGACCGTGCACCTGTTCATCGACACGCACCGAGTGCTCAGAGCGCGGGCCCATCGCTCGCTACAAACCAGCACGCATTCACTACAGCATCGCCGCTCCTTCAGCTACCGCTCGCGCTACCGCTGGAGGCAAGGCCCAAACCGCTCATCTGACTCCCGGTCGCGTGAACCCTCTCCCGCCCGTCAGGGGAACGACCTCGGCCTGTACGCGCTGGGACGAACACTTCCACCATCAGCTGCTCACCCACTCGCGCACAACTCCCTCAGCTCTAGCCACGGCTTCGCACACTTTCATAACTCTGTCATTGCTAATAACAGCTTTGCTAACCCTCAAACATTCCCAATG

Function

GO:

id name namespace
GO:0051968 positive regulation of synaptic transmission, glutamatergic biological_process
GO:0019226 transmission of nerve impulse biological_process
GO:0034765 regulation of ion transmembrane transport biological_process
GO:0070588 calcium ion transmembrane transport biological_process
GO:0098943 neurotransmitter receptor transport, postsynaptic endosome to lysosome biological_process
GO:0098970 postsynaptic neurotransmitter receptor diffusion trapping biological_process
GO:2000311 regulation of AMPA receptor activity biological_process
GO:0006811 ion transport biological_process
GO:0006816 calcium ion transport biological_process
GO:0099590 neurotransmitter receptor internalization biological_process
GO:0098839 postsynaptic density membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0032281 AMPA glutamate receptor complex cellular_component
GO:0005244 voltage-gated ion channel activity molecular_function
GO:0005245 voltage-gated calcium channel activity molecular_function
GO:0016247 channel regulator activity molecular_function
GO:0005262 calcium channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090312-124 Predicted to enable channel regulator activity and voltage-gated calcium channel activity. Predicted to be involved in several processes, including neurotransmitter receptor internalization; neurotransmitter receptor transport, postsynaptic endosome to lysosome; and postsynaptic neurotransmitter receptor diffusion trapping. Predicted to act upstream of or within calcium ion transmembrane transport and regulation of ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of AMPA glutamate receptor complex. Predicted to be active in postsynaptic density membrane. Human ortholog(s) of this gene implicated in childhood absence epilepsy and macular degeneration. Orthologous to human CACNG3 (calcium voltage-gated channel auxiliary subunit gamma 3).

Ensembl:

ensembl_id ENSDART00000146303

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003031 lncRNA upstream 105995 8967479 ~ 8976422 (+) True XLOC_000106
TCONS_00003029 lncRNA upstream 116478 8950874 ~ 8965939 (+) False XLOC_000105
TCONS_00000198 lncRNA upstream 116478 8950874 ~ 8965939 (+) False XLOC_000105
TCONS_00003030 lncRNA upstream 116478 8961004 ~ 8965939 (+) True XLOC_000105
TCONS_00000197 lncRNA upstream 383306 8694291 ~ 8699111 (+) True XLOC_000104
TCONS_00003032 lncRNA downstream 37727 9129386 ~ 9132490 (+) True XLOC_000111
TCONS_00003033 lncRNA downstream 62435 9154094 ~ 9155521 (+) False XLOC_000113
TCONS_00000210 lncRNA downstream 65717 9157376 ~ 9161475 (+) True XLOC_000113
TCONS_00000214 lncRNA downstream 186187 9277846 ~ 9285351 (+) True XLOC_000116
TCONS_00000220 lncRNA downstream 795296 9886955 ~ 9914630 (+) False XLOC_000120
TCONS_00000203 mRNA upstream 7938 9071324 ~ 9074479 (+) True XLOC_000109
TCONS_00000201 mRNA upstream 17505 9004719 ~ 9064912 (+) False XLOC_000108
TCONS_00000202 mRNA upstream 38070 9004752 ~ 9044347 (+) True XLOC_000108
TCONS_00000199 mRNA upstream 93913 8984068 ~ 8988504 (+) False XLOC_000107
TCONS_00000200 mRNA upstream 93913 8986138 ~ 8988504 (+) True XLOC_000107
TCONS_00000206 mRNA downstream 53299 9144958 ~ 9145896 (+) True XLOC_000112
TCONS_00000207 mRNA downstream 61482 9153141 ~ 9161843 (+) False XLOC_000113
TCONS_00000211 mRNA downstream 107372 9199031 ~ 9227204 (+) False XLOC_000114
TCONS_00000212 mRNA downstream 107490 9199149 ~ 9206616 (+) True XLOC_000114
TCONS_00000215 mRNA downstream 198444 9290103 ~ 9294115 (+) True XLOC_000117
TCONS_00000154 other upstream 2018474 7063837 ~ 7063943 (+) True XLOC_000081
TCONS_00000149 other upstream 2294613 6787690 ~ 6787804 (+) True XLOC_000078
TCONS_00000134 other upstream 2896885 6182342 ~ 6185532 (+) False XLOC_000067
TCONS_00000123 other upstream 3580333 5497285 ~ 5502084 (+) True XLOC_000062
TCONS_00000121 other upstream 3631973 5438743 ~ 5450444 (+) False XLOC_000062
TCONS_00000208 other downstream 62435 9154094 ~ 9155273 (+) False XLOC_000113
TCONS_00000209 other downstream 63334 9154993 ~ 9155521 (+) False XLOC_000113
TCONS_00000213 other downstream 126989 9218648 ~ 9221616 (+) True XLOC_000115
TCONS_00000230 other downstream 960115 10051774 ~ 10054771 (+) False XLOC_000126
TCONS_00000231 other downstream 960125 10051784 ~ 10058057 (+) False XLOC_000126

Expression Profile

//