RNA id: TCONS_00025261



Basic Information


Item Value
RNA id TCONS_00025261
length 496
RNA type processed_transcript
GC content 0.46
exon number 4
gene id XLOC_012623
representative True

Chromosome Information


Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 9615147 ~ 9722291 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TTCACACTGACATCCAGAGCATGATGAACCCTCTGTTACCTCATTTCCCCTTGCAAGTAAAAATCCCAGGCCCTTACCCTCAGATCAAACCCATATCAATGTCCGCATGACTGTGGTGTGTAAAAATCATGAGCTGGTTTCATGTGAGGGCGAACGTGGATGTGAGAGTCCGTGTAGAAAAACAGCCCCATCTAAAGGCAGAACTGGCCTCATACTGATCATGCAACATCTTCCAGCCAATGAGAGCAAAGTATCGAGTCAGATGACCATCATGGAGGGATCTCTGCTAGAGGAGATAAAACCAACCACAGAATGACGGATGGAGAAGGATACACTCTGGACAGTGAAGATAGCATGGGGACTAATGCTTTGGACAGTGCCATATTTCAAGTCCCCCAGATGAAAAACATCCCGAATGGAACCGATAAAACCAGAGGACTTGAATCTTTAAACTTGCCTGACTCCGAAGGTAAGATGATGGGAGAGATAAAAGTTG

Function


GO:

id name namespace
GO:1904071 presynaptic active zone assembly biological_process
GO:0035418 protein localization to synapse biological_process
GO:0007416 synapse assembly biological_process
GO:0030424 axon cellular_component
GO:0048786 presynaptic active zone cellular_component
GO:0048788 cytoskeleton of presynaptic active zone cellular_component
GO:0045202 synapse cellular_component
GO:0098978 glutamatergic synapse cellular_component
GO:0098982 GABA-ergic synapse cellular_component
GO:0016020 membrane cellular_component
GO:0046872 metal ion binding molecular_function
GO:0098882 structural constituent of presynaptic active zone molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-8100 Predicted to be a structural constituent of presynaptic active zone. Predicted to be involved in presynaptic active zone assembly and protein localization to synapse. Predicted to act upstream of or within synapse assembly. Predicted to be located in cell projection; membrane; and presynaptic active zone. Predicted to be active in several cellular components, including GABA-ergic synapse; cytoskeleton of presynaptic active zone; and glutamatergic synapse. Is expressed in brain; cerebellum; hindbrain; and torus longitudinalis. Human ortholog(s) of this gene implicated in pontocerebellar hypoplasia type 3. Orthologous to human PCLO (piccolo presynaptic cytomatrix protein).

Ensembl:

ensembl_id ENSDART00000173169

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00025224 lncRNA upstream 1370418 8334388 ~ 8338157 (+) False XLOC_012608
TCONS_00025226 lncRNA upstream 1370418 8335139 ~ 8338157 (+) True XLOC_012608
TCONS_00025225 lncRNA upstream 1373196 8334502 ~ 8335379 (+) False XLOC_012608
TCONS_00025221 lncRNA upstream 1605379 8100905 ~ 8103196 (+) True XLOC_012606
TCONS_00027056 lncRNA upstream 2044918 7651829 ~ 7663657 (+) True XLOC_012602
TCONS_00025265 lncRNA downstream 265110 9980878 ~ 9983912 (+) True XLOC_012626
TCONS_00026870 lncRNA downstream 369873 10085641 ~ 10089253 (+) True XLOC_012629
TCONS_00027057 lncRNA downstream 387173 10102941 ~ 10190202 (+) False XLOC_012630
TCONS_00027058 lncRNA downstream 390507 10106275 ~ 10151626 (+) False XLOC_012630
TCONS_00025269 lncRNA downstream 390507 10106275 ~ 10157525 (+) False XLOC_012630
TCONS_00025255 mRNA upstream 131797 9493720 ~ 9576778 (+) True XLOC_012621
TCONS_00025252 mRNA upstream 268653 9323211 ~ 9439922 (+) False XLOC_012620
TCONS_00025253 mRNA upstream 268653 9362455 ~ 9439922 (+) False XLOC_012620
TCONS_00025254 mRNA upstream 268653 9382847 ~ 9439922 (+) True XLOC_012620
TCONS_00025250 mRNA upstream 469900 9171778 ~ 9238675 (+) True XLOC_012618
TCONS_00025262 mRNA downstream 33607 9749375 ~ 9948604 (+) False XLOC_012624
TCONS_00025263 mRNA downstream 94874 9810642 ~ 9820299 (+) True XLOC_012624
TCONS_00025266 mRNA downstream 281045 9996813 ~ 10062630 (+) True XLOC_012627
TCONS_00025272 mRNA downstream 974004 10689772 ~ 10690365 (+) True XLOC_012634
TCONS_00025274 mRNA downstream 1068962 10784730 ~ 10879626 (+) False XLOC_012636
TCONS_00025256 other upstream 100533 9607916 ~ 9608042 (+) True XLOC_012622
TCONS_00025251 other upstream 484047 9224413 ~ 9224528 (+) True XLOC_012619
TCONS_00025249 other upstream 596643 9111816 ~ 9111932 (+) True XLOC_012617
TCONS_00025241 other upstream 798963 8901862 ~ 8909612 (+) False XLOC_012614
TCONS_00025238 other upstream 815778 8889888 ~ 8892797 (+) False XLOC_012613
TCONS_00025264 other downstream 95252 9811020 ~ 9811152 (+) True XLOC_012625
TCONS_00025267 other downstream 300740 10016508 ~ 10016626 (+) True XLOC_012628
TCONS_00025271 other downstream 954893 10670661 ~ 10670738 (+) True XLOC_012633
TCONS_00025273 other downstream 1026281 10742049 ~ 10742163 (+) True XLOC_012635
TCONS_00025282 other downstream 1741445 11457213 ~ 11457330 (+) True XLOC_012639

Expression Profile


//