RNA id: TCONS_00030773


Basic Information

Item Value
RNA id TCONS_00030773
length 99
RNA type processed_transcript
GC content 0.45
exon number 1
gene id XLOC_015372
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 20725684 ~ 20776841 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCCGTCCAGGACGGCGAAACGAGACAGTTTGCCACTAAACTGGACACTTCTTTCATATTCGTCCAAACATGGATAATAACGACACATATCTCCATCTCA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0048856 anatomical structure development biological_process
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0048384 retinoic acid receptor signaling pathway biological_process
GO:0032526 response to retinoic acid biological_process
GO:0090575 RNA polymerase II transcription regulator complex cellular_component
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0004879 nuclear receptor activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0003707 steroid hormone receptor activity molecular_function
GO:0008270 zinc ion binding molecular_function
GO:0044323 retinoic acid-responsive element binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-980526-36 Enables nuclear receptor activity. Involved in positive regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of RNA polymerase II transcription regulator complex. Is expressed in several structures, including mesoderm; neural rod; pharyngeal arch; retina; and tail bud. Human ortholog(s) of this gene implicated in lung non-small cell carcinoma. Orthologous to human RXRG (retinoid X receptor gamma).

Ensembl:

ensembl_id ENSDART00000148400

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033254 lncRNA upstream 252397 20472150 ~ 20473316 (+) False XLOC_015368
TCONS_00033515 lncRNA upstream 1046384 19659710 ~ 19679329 (+) True XLOC_015363
TCONS_00033514 lncRNA upstream 1076372 19640952 ~ 19649341 (+) False XLOC_015362
TCONS_00033253 lncRNA upstream 1108924 19614953 ~ 19616789 (+) True XLOC_015359
TCONS_00033513 lncRNA upstream 1130519 19590044 ~ 19595194 (+) True XLOC_015358
TCONS_00030787 lncRNA downstream 364506 21090317 ~ 21124019 (+) False XLOC_015379
TCONS_00030792 lncRNA downstream 449250 21175061 ~ 21177376 (+) False XLOC_015380
TCONS_00030794 lncRNA downstream 452234 21178045 ~ 21180098 (+) True XLOC_015380
TCONS_00030796 lncRNA downstream 460114 21185925 ~ 21186788 (+) False XLOC_015381
TCONS_00030804 lncRNA downstream 630911 21356722 ~ 21368214 (+) True XLOC_015383
TCONS_00030770 mRNA upstream 110074 20605925 ~ 20615639 (+) True XLOC_015370
TCONS_00030768 mRNA upstream 110079 20604775 ~ 20615634 (+) False XLOC_015370
TCONS_00030769 mRNA upstream 111013 20605186 ~ 20614700 (+) False XLOC_015370
TCONS_00030767 mRNA upstream 169970 20539402 ~ 20555743 (+) True XLOC_015369
TCONS_00030766 mRNA upstream 222018 20496223 ~ 20503695 (+) True XLOC_015368
TCONS_00030774 mRNA downstream 68171 20793982 ~ 20812059 (+) False XLOC_015373
TCONS_00030775 mRNA downstream 69431 20795242 ~ 20801305 (+) False XLOC_015373
TCONS_00030776 mRNA downstream 77065 20802876 ~ 20811176 (+) True XLOC_015373
TCONS_00030777 mRNA downstream 141087 20866898 ~ 20879820 (+) False XLOC_015374
TCONS_00030778 mRNA downstream 142475 20868286 ~ 20879583 (+) True XLOC_015374
TCONS_00030771 other upstream 92186 20632221 ~ 20633527 (+) True XLOC_015371
TCONS_00030758 other upstream 931932 19790685 ~ 19793781 (+) True XLOC_015364
TCONS_00030756 other upstream 931943 19784959 ~ 19793770 (+) False XLOC_015364
TCONS_00030754 other upstream 1076372 19640952 ~ 19649341 (+) True XLOC_015362
TCONS_00030752 other upstream 1096919 19628697 ~ 19628794 (+) True XLOC_015360
TCONS_00030786 other downstream 341923 21067734 ~ 21073795 (+) True XLOC_015378
TCONS_00030793 other downstream 450139 21175950 ~ 21177665 (+) False XLOC_015380
TCONS_00030797 other downstream 460566 21186377 ~ 21243018 (+) False XLOC_015381
TCONS_00030805 other downstream 649656 21375467 ~ 21375594 (+) True XLOC_015384
TCONS_00030832 other downstream 1934260 22660071 ~ 22666700 (+) True XLOC_015401