RNA id: TCONS_00037946



Basic Information


Item Value
RNA id TCONS_00037946
length 535
lncRNA type retained_intron
GC content 0.45
exon number 2
gene id XLOC_019170
representative True

Chromosome Information


Item Value
chromosome id NC_007132.7
NCBI id CM002905.2
chromosome length 45934066
location 42717424 ~ 42780082 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AGAGATTAAGGCATGGAACTTTGCAAATGAAACTTGCTGATACATTCACAAGAGAGAAAATCTGAACCTAGATGGTTTGGGATTTTGACATGCTAACCCTTGTTCAATCTCTACTTGCAGCCACGAGGAGTAAACCTACCTAAACCTCCAGTGCCCCCACAAGTAGAGGAGGAGTATTACACCATAGCTGACTTCCAGACAACCATCCCAGATGGCATTAGCTTCCAGGCAGGACTGAAAGTGGAAGTGATCGAGAAGAACTCCAGTGGCTGGTGGTATATTCAGATAGAAGATAAAGAAGGCTGGGCTCCAGTCACATTCATTGATAAATACAAGAAGACTAGCAGTGCCTCTAGACCTAACTTCTTGGCCCCACTTCCTGGTGAGATGGAACAGTTGAAGCTTGAAGATACCTCAAGTAATAGTACCAACTCTGAACATACTTGGTCCAAACCCCTGCCTGATGAACCTTCATCCAACTCTGATCTTTCCACCCGTTCCAAACTGAGAGAATGGAAGCCCAATGCAGCCAAAA

Function


GO:

id name namespace
GO:0071800 podosome assembly biological_process
GO:0060348 bone development biological_process
GO:0007507 heart development biological_process
GO:0006801 superoxide metabolic process biological_process
GO:0001654 eye development biological_process
GO:0005737 cytoplasm cellular_component
GO:0070273 phosphatidylinositol-4-phosphate binding molecular_function
GO:0016175 superoxide-generating NAD(P)H oxidase activity molecular_function
GO:0016176 superoxide-generating NADPH oxidase activator activity molecular_function
GO:0035091 phosphatidylinositol binding molecular_function
GO:0080025 phosphatidylinositol-3,5-bisphosphate binding molecular_function
GO:0032266 phosphatidylinositol-3-phosphate binding molecular_function
GO:0010314 phosphatidylinositol-5-phosphate binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060810-52 Predicted to enable superoxide-generating NADPH oxidase activator activity. Predicted to be involved in superoxide anion generation. Predicted to act upstream of or within animal organ development and podosome assembly. Predicted to be located in cell projection and podosome. Predicted to be active in cytoplasm. Is expressed in several structures, including central nervous system; notochord; otic vesicle; segmental plate; and tail bud. Human ortholog(s) of this gene implicated in Frank-Ter Haar syndrome. Orthologous to human SH3PXD2B (SH3 and PX domains 2B).

Ensembl:

ensembl_id ENSDART00000160502

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00039489 lncRNA upstream 98998 42663889 ~ 42677526 (+) False XLOC_019167
TCONS_00039490 lncRNA upstream 98998 42664072 ~ 42677526 (+) False XLOC_019167
TCONS_00039491 lncRNA upstream 98998 42664898 ~ 42677526 (+) False XLOC_019167
TCONS_00039202 lncRNA upstream 99228 42674388 ~ 42677296 (+) True XLOC_019167
TCONS_00039488 lncRNA upstream 622068 42150564 ~ 42154456 (+) True XLOC_019165
TCONS_00039492 lncRNA downstream 100644 42877788 ~ 42887367 (+) True XLOC_019172
TCONS_00037948 lncRNA downstream 114474 42891618 ~ 42967951 (+) False XLOC_019173
TCONS_00039493 lncRNA downstream 190611 42967755 ~ 42985641 (+) False XLOC_019173
TCONS_00037950 lncRNA downstream 190645 42967789 ~ 42985641 (+) False XLOC_019173
TCONS_00039494 lncRNA downstream 194785 42971929 ~ 42985641 (+) True XLOC_019173
TCONS_00037942 mRNA upstream 60677 42708621 ~ 42715847 (+) False XLOC_019169
TCONS_00037943 mRNA upstream 60755 42713845 ~ 42715769 (+) True XLOC_019169
TCONS_00037940 mRNA upstream 402296 42226113 ~ 42374228 (+) True XLOC_019166
TCONS_00037938 mRNA upstream 914445 41839443 ~ 41862079 (+) False XLOC_019162
TCONS_00037937 mRNA upstream 915016 41837610 ~ 41861508 (+) False XLOC_019162
TCONS_00037949 mRNA downstream 153414 42930558 ~ 42964126 (+) False XLOC_019173
TCONS_00037952 mRNA downstream 393869 43171013 ~ 43173766 (+) False XLOC_019176
TCONS_00037953 mRNA downstream 395362 43172506 ~ 43177239 (+) False XLOC_019176
TCONS_00037956 mRNA downstream 401687 43178831 ~ 43214010 (+) False XLOC_019177
TCONS_00037957 mRNA downstream 416479 43193623 ~ 43272711 (+) True XLOC_019178
TCONS_00037941 other upstream 108490 42667915 ~ 42668034 (+) True XLOC_019168
TCONS_00037932 other upstream 1136466 41639979 ~ 41640058 (+) True XLOC_019160
TCONS_00037914 other upstream 2375512 40400938 ~ 40401012 (+) True XLOC_019145
TCONS_00037913 other upstream 2375736 40400714 ~ 40400788 (+) True XLOC_019144
TCONS_00037853 other upstream 4207123 38569285 ~ 38569401 (+) True XLOC_019097
TCONS_00037947 other downstream 63812 42840956 ~ 42841071 (+) True XLOC_019171
TCONS_00037951 other downstream 282104 43059248 ~ 43059365 (+) True XLOC_019174
TCONS_00037955 other downstream 401673 43178817 ~ 43206304 (+) False XLOC_019177
TCONS_00037972 other downstream 924866 43702010 ~ 43710210 (+) False XLOC_019189
TCONS_00037974 other downstream 928464 43705608 ~ 43705684 (+) True XLOC_019190

Expression Profile


//