RNA id: TCONS_00041513


Basic Information

Item Value
RNA id TCONS_00041513
length 89
RNA type miRNA
GC content 0.42
exon number 1
gene id XLOC_021142
representative False

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 22825425 ~ 22861498 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAAAGGTCACAATCAACATTCATTGCTGTCGGTGGGTTGGATTGTAAAAGAAAGCTCACTGAACAATGAATGCAACTGTGTCCCAGATT

Function

GO:

id name namespace
GO:0048731 system development biological_process
GO:0014809 regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion biological_process
GO:0090257 regulation of muscle system process biological_process
GO:0050879 multicellular organismal movement biological_process
GO:0050881 musculoskeletal movement biological_process
GO:0014819 regulation of skeletal muscle contraction biological_process
GO:0006937 regulation of muscle contraction biological_process
GO:0001501 skeletal system development biological_process
GO:0007275 multicellular organism development biological_process
GO:0043062 extracellular structure organization biological_process
GO:0030198 extracellular matrix organization biological_process
GO:0048856 anatomical structure development biological_process
GO:0003009 skeletal muscle contraction biological_process
GO:0032501 multicellular organismal process biological_process
GO:0032502 developmental process biological_process
GO:0014722 regulation of skeletal muscle contraction by calcium ion signaling biological_process
GO:0099080 supramolecular complex cellular_component
GO:0099081 supramolecular polymer cellular_component
GO:0043292 contractile fiber cellular_component
GO:0030426 growth cone cellular_component
GO:0030427 site of polarized growth cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0005581 collagen trimer cellular_component
GO:0099512 supramolecular fiber cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific molecular_function
GO:0005201 extracellular matrix structural constituent molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000117492

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00042406 lncRNA downstream 37062 22770522 ~ 22788728 (-) True XLOC_021141
TCONS_00042405 lncRNA downstream 302335 22342385 ~ 22523455 (-) True XLOC_021137
TCONS_00042403 lncRNA downstream 700050 22072007 ~ 22125740 (-) False XLOC_021130
TCONS_00042404 lncRNA downstream 700050 22074569 ~ 22125740 (-) True XLOC_021130
TCONS_00041957 lncRNA downstream 751160 22050297 ~ 22074630 (-) False XLOC_021130
TCONS_00041958 lncRNA upstream 1749 22827627 ~ 22861493 (-) True XLOC_021142
TCONS_00041528 lncRNA upstream 767179 23593057 ~ 23596961 (-) False XLOC_021151
TCONS_00042410 lncRNA upstream 769266 23595144 ~ 23596038 (-) True XLOC_021151
TCONS_00041532 lncRNA upstream 796010 23621888 ~ 23622443 (-) False XLOC_021152
TCONS_00041533 lncRNA upstream 796205 23622083 ~ 23625177 (-) True XLOC_021152
TCONS_00041512 mRNA downstream 106350 22634007 ~ 22719440 (-) True XLOC_021140
TCONS_00041509 mRNA downstream 409453 22345136 ~ 22416337 (-) False XLOC_021138
TCONS_00041510 mRNA downstream 409453 22345199 ~ 22416337 (-) True XLOC_021138
TCONS_00041507 mRNA downstream 485102 22316855 ~ 22340688 (-) False XLOC_021136
TCONS_00041508 mRNA downstream 488408 22329401 ~ 22337382 (-) True XLOC_021136
TCONS_00041515 mRNA upstream 151390 22977268 ~ 23000815 (-) False XLOC_021144
TCONS_00041516 mRNA upstream 151935 22977813 ~ 23006842 (-) False XLOC_021144
TCONS_00041517 mRNA upstream 179015 23004893 ~ 23067859 (-) True XLOC_021144
TCONS_00041518 mRNA upstream 279181 23105059 ~ 23228669 (-) True XLOC_021145
TCONS_00041519 mRNA upstream 412912 23238790 ~ 23253252 (-) False XLOC_021146
TCONS_00041511 other downstream 291327 22533586 ~ 22534463 (-) True XLOC_021139
TCONS_00041498 other downstream 888302 21933125 ~ 21937488 (-) True XLOC_021128
TCONS_00041483 other downstream 1649646 21167096 ~ 21176144 (-) False XLOC_021120
TCONS_00041481 other downstream 1706774 21118902 ~ 21119016 (-) True XLOC_021117
TCONS_00041464 other downstream 2335233 20490441 ~ 20490557 (-) True XLOC_021106
TCONS_00041514 other upstream 118583 22944461 ~ 22944585 (-) True XLOC_021143
TCONS_00041524 other upstream 670937 23496815 ~ 23496929 (-) True XLOC_021149
TCONS_00041540 other upstream 926708 23752586 ~ 23754415 (-) True XLOC_021156
TCONS_00041541 other upstream 932077 23757955 ~ 23758641 (-) True XLOC_021157
TCONS_00041548 other upstream 1143202 23969080 ~ 23969709 (-) True XLOC_021159