RNA id: TCONS_00055220


Basic Information

Item Value
RNA id TCONS_00055220
length 701
RNA type processed_transcript
GC content 0.51
exon number 6
gene id XLOC_028449
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 4484651 ~ 4507761 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAGATCCTGCCTCACGACTCAAACACACGCAGAAATGCTGCTAACTTCACTTTAGGTCTGTCTGTCATTTTAATAGCATGAAACAGTAACACAGATGGACTCAGGAGTGGACACCAGGTTGAAGTTCACTATCGAACCCTCTCTAGGCAAGAACGGCTTTCAGCAATGGTACGACGCTCTGAAAGCAGTGGCCAGACTGCCGGTCGGCATTCCCAAAGAGTGGAGGAAAAGAGTCTGGCTGACCCTGGCTGACCAGTATCTTCACAGCATCTCTATAGACTGGGAGAAAACCATGAGATTTGCCTTCAATGACCGCAGCAATCCAGACGATGACTCTTTGGGAATACAAATAGTAAAGGATCTGCACCGGACAGGCTGCAGCTCTTACTGTGGGCAGGAGGCGGAGCAGGACCGGGTGGTGCTGAAGCGGGTGCTGCTGGCTTATGCCCGCTGGAACAAGACTGTAGGATACTGTCAGGGATTTAATGTGCTGGCGGCACTTATCCTGGAGGTCACTGAGGGCAATGAAGGAGACGCTTTAAAGGTGATGATCTATTTGATCGACAAGGTGCTTCCGGACAGTTATTTCGCCAATAATCTGCGAGCACTCTCTGTGGACATGGCCGTGTTCAGAGACCTGCTGCGGCTGAAGCTTCCAGAACTTTCTCAGCACCTTCACCACCTCCAAAAAGTGGCCAATC

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0090630 activation of GTPase activity biological_process
GO:0005096 GTPase activator activity molecular_function

KEGG:

id description
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-030131-2064 Predicted to enable GTPase activator activity. Predicted to be involved in activation of GTPase activity and intracellular protein transport. Orthologous to human TBC1D30 (TBC1 domain family member 30).

Ensembl:

ensembl_id ENSDART00000156496

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00055216 lncRNA downstream 117862 4321168 ~ 4374704 (-) True XLOC_028446
TCONS_00055214 lncRNA downstream 236291 4238000 ~ 4256275 (-) False XLOC_028445
TCONS_00055208 lncRNA downstream 263411 4224273 ~ 4229155 (-) True XLOC_028443
TCONS_00057997 lncRNA downstream 263498 4178834 ~ 4229068 (-) False XLOC_028443
TCONS_00057998 lncRNA downstream 263498 4183439 ~ 4229068 (-) False XLOC_028443
TCONS_00055221 lncRNA upstream 17647 4514438 ~ 4516508 (-) True XLOC_028450
TCONS_00058006 lncRNA upstream 443676 4940467 ~ 4962892 (-) False XLOC_028461
TCONS_00057318 lncRNA upstream 459161 4955952 ~ 4961841 (-) True XLOC_028461
TCONS_00058009 lncRNA upstream 466166 4962957 ~ 4966824 (-) False XLOC_028462
TCONS_00058011 lncRNA upstream 466166 4962957 ~ 4966824 (-) False XLOC_028462
TCONS_00055218 mRNA downstream 60591 4397503 ~ 4431975 (-) True XLOC_028448
TCONS_00055217 mRNA downstream 105554 4376498 ~ 4387012 (-) True XLOC_028447
TCONS_00055215 mRNA downstream 230893 4240262 ~ 4261673 (-) True XLOC_028445
TCONS_00055212 mRNA downstream 233464 4235305 ~ 4259102 (-) False XLOC_028445
TCONS_00055211 mRNA downstream 233487 4235262 ~ 4259079 (-) False XLOC_028445
TCONS_00055222 mRNA upstream 29457 4526248 ~ 4535189 (-) True XLOC_028451
TCONS_00055223 mRNA upstream 43432 4540223 ~ 4592287 (-) False XLOC_028452
TCONS_00055224 mRNA upstream 43727 4540518 ~ 4570475 (-) False XLOC_028452
TCONS_00055226 mRNA upstream 105024 4601815 ~ 4612116 (-) True XLOC_028453
TCONS_00055227 mRNA upstream 130003 4626794 ~ 4706893 (-) True XLOC_028454
TCONS_00055185 other downstream 1806476 2675106 ~ 2686090 (-) False XLOC_028423
TCONS_00055166 other downstream 2329842 2060524 ~ 2162724 (-) False XLOC_028412
TCONS_00055131 other downstream 3543724 937229 ~ 948842 (-) True XLOC_028386
TCONS_00055123 other downstream 3684113 804147 ~ 808453 (-) True XLOC_028380
TCONS_00055111 other downstream 3807147 683052 ~ 685419 (-) True XLOC_028374
TCONS_00055225 other upstream 49418 4546209 ~ 4570805 (-) True XLOC_028452
TCONS_00055239 other upstream 433620 4930411 ~ 4932524 (-) True XLOC_028460
TCONS_00055263 other upstream 873265 5370056 ~ 5371622 (-) True XLOC_028470
TCONS_00055293 other upstream 1939973 6436764 ~ 6451732 (-) False XLOC_028490
TCONS_00055295 other upstream 2068862 6565653 ~ 6567266 (-) True XLOC_028490

Expression Profile

//