RNA id: TCONS_00000069


Basic Information

Item Value
RNA id TCONS_00000069
length 313
RNA type processed_transcript
GC content 0.51
exon number 2
gene id XLOC_000036
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 1712140 ~ 1796832 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGGTACTGCCAGAGGAATTGTCATCAACACTGGTGACCGCACAGTCATGGGTCGCATCGCCACTCTCGCTTCTGGCCTTGAAGTTGGTCGCACCCCCATCTCTATTGAGATCGAGCACTTCATCCACATCATCACTGGTGTAGCTGTCTTCCTGGGTGTGTCCTTCTTCATCCTCTCCCTCATCCTTGGGTACAGTTGGTTGGAGGCTGTCATCTTCCTGATTGGTATCATTGTTGCGAATGTACCAGAGGGTCTCTTGGCTACTGTAACTGTGTGTCTGACTCTCACTGCCAAACGAATGGCAAAGAAGAAC

Function

GO:

id name namespace
GO:0006883 cellular sodium ion homeostasis biological_process
GO:1902600 proton transmembrane transport biological_process
GO:0007507 heart development biological_process
GO:0002027 regulation of heart rate biological_process
GO:0003143 embryonic heart tube morphogenesis biological_process
GO:0071599 otic vesicle development biological_process
GO:0021591 ventricular system development biological_process
GO:0036376 sodium ion export across plasma membrane biological_process
GO:0030198 extracellular matrix organization biological_process
GO:0035050 embryonic heart tube development biological_process
GO:0035051 cardiocyte differentiation biological_process
GO:0010172 embryonic body morphogenesis biological_process
GO:0048840 otolith development biological_process
GO:0060974 cell migration involved in heart formation biological_process
GO:0048854 brain morphogenesis biological_process
GO:0007368 determination of left/right symmetry biological_process
GO:0030007 cellular potassium ion homeostasis biological_process
GO:0008016 regulation of heart contraction biological_process
GO:0006811 ion transport biological_process
GO:0006813 potassium ion transport biological_process
GO:0007420 brain development biological_process
GO:1990573 potassium ion import across plasma membrane biological_process
GO:0030916 otic vesicle formation biological_process
GO:0030917 midbrain-hindbrain boundary development biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005391 sodium molecular_function
GO:0005524 ATP binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0008556 potassium transmembrane transporter activity, phosphorylative mechanism molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-001212-1 Enables P-type sodium:potassium-exchanging transporter activity. Acts upstream of or within several processes, including animal organ development; embryonic body morphogenesis; and regulation of heart rate. Predicted to be integral component of membrane. Is expressed in several structures, including cardiovascular system; immature eye; mesoderm; nervous system; and pronephros. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease type 2DD. Orthologous to human ATP1A1 (ATPase Na+/K+ transporting subunit alpha 1).

Ensembl:

ensembl_id ENSDART00000147682

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00000065 lncRNA upstream 12731 1705130 ~ 1705880 (+) True XLOC_000035
TCONS_00000064 lncRNA upstream 27586 1690047 ~ 1691025 (+) False XLOC_000035
TCONS_00003014 lncRNA upstream 99297 1617203 ~ 1619314 (+) False XLOC_000034
TCONS_00000077 lncRNA downstream 105538 1898909 ~ 1899843 (+) True XLOC_000039
TCONS_00003015 lncRNA downstream 208345 2001716 ~ 2005632 (+) True XLOC_000043
TCONS_00002808 lncRNA downstream 230038 2023409 ~ 2023645 (+) True XLOC_000044
TCONS_00000101 lncRNA downstream 503220 2296591 ~ 2299546 (+) True XLOC_000048
TCONS_00003016 lncRNA downstream 1925295 3718666 ~ 3720603 (+) True XLOC_000053
TCONS_00000063 mRNA upstream 12452 1689775 ~ 1706159 (+) False XLOC_000035
TCONS_00000062 mRNA upstream 104111 1599979 ~ 1614500 (+) True XLOC_000033
TCONS_00000059 mRNA upstream 747660 961607 ~ 970951 (+) True XLOC_000027
TCONS_00000058 mRNA upstream 1110364 604127 ~ 608247 (+) True XLOC_000025
TCONS_00000057 mRNA upstream 1110556 594736 ~ 608055 (+) False XLOC_000025
TCONS_00000074 mRNA downstream 11923 1805294 ~ 1815660 (+) True XLOC_000037
TCONS_00000075 mRNA downstream 44793 1838164 ~ 1850104 (+) True XLOC_000038
TCONS_00000076 mRNA downstream 103366 1896737 ~ 1899848 (+) False XLOC_000039
TCONS_00000078 mRNA downstream 111048 1904419 ~ 1911381 (+) True XLOC_000040
TCONS_00000079 mRNA downstream 122596 1915967 ~ 1923253 (+) True XLOC_000041
TCONS_00000067 other upstream 84 1712153 ~ 1718527 (+) False XLOC_000036
TCONS_00000061 other upstream 143048 1575483 ~ 1575563 (+) True XLOC_000032
TCONS_00000060 other upstream 499806 1218691 ~ 1218805 (+) True XLOC_000029
TCONS_00000053 other upstream 1142090 576444 ~ 576521 (+) True XLOC_000024
TCONS_00000052 other upstream 1172394 537589 ~ 546217 (+) False XLOC_000023
TCONS_00000094 other downstream 397329 2190700 ~ 2214397 (+) False XLOC_000046
TCONS_00000098 other downstream 478890 2272261 ~ 2288773 (+) False XLOC_000048
TCONS_00000099 other downstream 482234 2275605 ~ 2275742 (+) True XLOC_000049
TCONS_00000100 other downstream 493478 2286849 ~ 2299546 (+) False XLOC_000048
TCONS_00000102 other downstream 508587 2301958 ~ 2302623 (+) False XLOC_000050

Expression Profile

//