G239934


Basic Information

Item Value
gene id G239934
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000055
NCBI id null
chromosome length 6774723
location 4639722 ~ 4639974 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU272239
TTTATTTTCAAGAATGTGAATGTCTCAGTTGAGCATTATTTATTTGTATTCGGTACATTTCACTGTGGATTCTTTGGTAAATCAATCGCATTTCGGCGCAGGCTTTTTTTCCCCCATAGACTTTTGGAAAATCGCAAAAAATAAGCTCTGTGTTTAACAAAGGGTTATGACATTTACACGTTTTGTCCATCAAGATCATTTTCTCAGATGAACACAACTTTTATGAAGTTTGAAGCCTAAATGCAGTCGCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU272239 True 253 lncRNA 0.36 1 4639722 4639974

Neighbor

gene id symbol gene type direction distance location
CI01000055_04565665_04574485 NA coding upstream 65017 4565665 ~ 4574705 (+)
CI01000055_04429659_04441786 PKMB coding upstream 197191 4429659 ~ 4442531 (+)
CI01000055_04334410_04337430 NA coding upstream 302292 4334304 ~ 4337430 (+)
CI01000055_04331311_04334095 NA coding upstream 305472 4331311 ~ 4334250 (+)
CI01000055_04315348_04320581 NA coding upstream 319141 4315043 ~ 4320581 (+)
CI01000055_04644727_04647551 PIM3 coding downstream 4156 4644130 ~ 4648605 (+)
CI01000055_04653437_04666121 BRD1B coding downstream 13408 4653382 ~ 4667047 (+)
CI01000055_04815417_04830336 PRR5L coding downstream 175272 4815246 ~ 4830907 (+)
CI01000055_04834611_04844496 API5 coding downstream 194637 4834611 ~ 4845302 (+)
CI01000055_04869576_04887020 HSD17B12, HSD17B12A coding downstream 229509 4869483 ~ 4887959 (+)
G239901 NA non-coding upstream 106710 4532790 ~ 4533012 (+)
G239900 NA non-coding upstream 107820 4531697 ~ 4531902 (+)
G239821 NA non-coding upstream 148289 4482822 ~ 4491433 (+)
G239890 NA non-coding upstream 156932 4482291 ~ 4482790 (+)
G239889 NA non-coding upstream 160049 4479439 ~ 4479673 (+)
G239935 NA non-coding downstream 83 4640057 ~ 4640357 (+)
G239937 NA non-coding downstream 2762 4642736 ~ 4643080 (+)
G239938 NA non-coding downstream 33938 4673912 ~ 4674184 (+)
G239944 NA non-coding downstream 39838 4679812 ~ 4680075 (+)
G239998 NA non-coding downstream 150711 4790685 ~ 4790903 (+)
CI01000055_04265119_04272728 NA other upstream 367007 4265119 ~ 4273913 (+)
G239755 NA other upstream 384630 4254210 ~ 4255092 (+)
G239761 NA other upstream 426320 4162250 ~ 4213402 (+)
CI01000055_02542526_02542861 NA other upstream 2095604 2542216 ~ 2544118 (+)
G238534 NA other upstream 2970478 1668410 ~ 1669244 (+)
CI01000055_05163240_05166231 PIGY, PYURF other downstream 525518 5162990 ~ 5166647 (+)
G240099 NA other downstream 896544 5525472 ~ 5544153 (+)
CI01000055_05614889_05616453 NA other downstream 974404 5614065 ~ 5617591 (+)
CI01000055_06087070_06088629 ETFRF1, LYRM5, LYRM5B other downstream 1446851 6087034 ~ 6088759 (+)
G240344 NA other downstream 1523886 6163860 ~ 6164011 (+)

Expression


Co-expression Network