CI01000057_01219430_01223491 (HNRNPA1, HNRNPA1A)



Basic Information


Item Value
gene id CI01000057_01219430_01223491
gene name HNRNPA1, HNRNPA1A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 1219430 ~ 1223491 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000057_01219430_01223491.mRNA
CAACAGACCCCCCGTGAGCCTGAGCAGCTCCGAAAGCTCTTTATCGGGGGTCTCAGTTTCGAGACAACAGATGAGAGTCTAAGGGCCCATTTCGAGCAATGGGGAACTCTTACAGACTGTGTGGTGATGAGGGACCCCAACACAAAGAGGTCGAGGGGTTTTGGGTTTGTGACCTACAGTTCGGTAGGTGAGGTGGATGCAGCGATGGACGCTCGTCCGCACAAAGTGGATGGAAGAGCTGTTGAACCCAAGAGGGCAGTTTCTAGAGAAGACTCGTCCAAACCAGGCGCTCACTCCACTGTTAAAAAGATTTTTGTGGGCGGAATCAAAGAAGACACGGATGAGGAACACTTGCGGGAATATTTCGGCCAGTTTGGTAAAATTGAAGAAGTGAACATCATGACAGAGAAGAACAGTGATAAGAGGAGGGGTTTCGCCTTCATAACATTTGATGACCATGACTCTGTTGACAGGATTGTCATTCAGAAGTACCATACGGTGAATGGACACAACTGTGAAGTCAGGAAAGCTCTGTCCAGAGAGGAAATGAACAGAGTCTCAATGAATCCACGAGGTGGGCGAGGGGGTGGTGGCGGAAACTTTGGCAGAGGAGGTGGATATGGAGGAGGCAACTTTGGAGGTGGAGGTGGTGGAGACTACAATGACTTTGGCAACTACAACCAGTCTTCCTCTAACTATGGCCCAATGAAGGGAGGAAACTACGGAGGTGGTGGAAGGAGCGGCGGCGGTGGCCCATATGGTG

Function


symbol description
hnrnpa1a Enables mRNA 3'-UTR binding activity. Is expressed in gut; head; nervous system; and trunk. Human ortholog(s) of this gene implicated in amyotrophic lateral sclerosis type 20; inclusion body myopathy with early-onset Paget disease of bone with or without frontotemporal dementia 3; and tropical spastic paraparesis. Orthologous to human HNRNPA1 (heterogeneous nuclear ribonucleoprotein A1).
hnrnpa1 Enables identical protein binding activity; nucleic acid binding activity; and protein domain specific binding activity. Involved in several processes, including cellular response to sodium arsenite; nucleocytoplasmic transport; and regulation of telomere maintenance via telomerase. Located in cytoplasm and nucleoplasm. Part of catalytic step 2 spliceosome. Implicated in amyotrophic lateral sclerosis type 20; inclusion body myopathy with early-onset Paget disease of bone with or without frontotemporal dementia 3; and tropical spastic paraparesis. Biomarker of Alzheimer's disease; hepatocellular carcinoma; and lung non-small cell carcinoma.

GO:

id name namespace
GO:0051168 nuclear export biological_process

KEGG:

id description
K12741 HNRNPA1_3; heterogeneous nuclear ribonucleoprotein A1/A3

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000057_01219430_01223491.mRNA True 763 mRNA 0.51 6 1219430 1223491

Neighbor


gene id symbol gene type direction distance location
CI01000057_01189209_01190703 SMUG1 coding downstream 28727 1188913 ~ 1190703 (-)
CI01000057_01145522_01147560 NA coding downstream 71658 1144062 ~ 1147772 (-)
CI01000057_01083731_01092073 NA coding downstream 126799 1083714 ~ 1092631 (-)
CI01000057_00956994_00965947 NR1D4B coding downstream 253483 955633 ~ 965947 (-)
CI01000057_00938618_00949690 NA coding downstream 269651 938071 ~ 949779 (-)
CI01000057_01235433_01244747 NA coding upstream 11686 1235177 ~ 1245182 (-)
CI01000057_01252690_01256408 ZNF740A coding upstream 29156 1252647 ~ 1256408 (-)
CI01000057_01261251_01262315 NA coding upstream 37195 1260686 ~ 1262315 (-)
CI01000057_01356170_01359401 NA coding upstream 131918 1355409 ~ 1359970 (-)
CI01000057_01471460_01487413 NA coding upstream 247636 1471127 ~ 1487762 (-)
G244548 NA non-coding downstream 8681 1208498 ~ 1210749 (-)
G244606 NA non-coding downstream 22595 1196572 ~ 1196835 (-)
G244558 NA non-coding downstream 26191 1192945 ~ 1193239 (-)
G244594 NA non-coding downstream 51938 1165176 ~ 1167492 (-)
G244524 NA non-coding downstream 190402 1008238 ~ 1029028 (-)
G244610 NA non-coding upstream 39536 1263027 ~ 1263250 (-)
G244616 NA non-coding upstream 60637 1284128 ~ 1284855 (-)
G244618 NA non-coding upstream 62591 1286082 ~ 1286340 (-)
G244619 NA non-coding upstream 63556 1287047 ~ 1287383 (-)
G244633 NA non-coding upstream 99364 1322855 ~ 1323236 (-)
G244358 NA other downstream 648402 570530 ~ 571028 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other upstream 578093 1801528 ~ 1806454 (-)
CI01000057_01904867_01921400 NA other upstream 696565 1904533 ~ 1921905 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 2668244 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 3705253 4927533 ~ 4931420 (-)
G246780 NA other upstream 3987619 5086312 ~ 5283617 (-)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_003822 hnrnpa1a coding NC_007122.7 CM002895.2 2240075 ~ 2250767 (-)