CI01000057_01711126_01748095 (MAPK14, MAPK14A, P38B, P38A, MAPK14B)



Basic Information


Item Value
gene id CI01000057_01711126_01748095
gene name MAPK14, MAPK14A, P38B, P38A, MAPK14B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 1711126 ~ 1748495 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000057_01711126_01748095.mRNA
CACTGAGATCAGGAGAGCAGCGCAGAAGTTTCCACTCCTCTACAGGAATGTCCCACAAGGAGAGACCGACTTTCTATCGACAGGAGCTCAATAAGACCATATGGGAGGTGCCGGAGCGGTACCAGAGTTTATCGCCCGTGGGCTCTGGAGCTTATGGATCCGTATGCTCCGCGTTAGACTCAAAGTCAGGCCTGAGGGTCGCAGTCAAGAAGCTGTCCCGGCCCTTCCAGTCCATCATCCACGCCAAGCGCACATACAGAGAACTGCGGCTGCTGAAACACATGAAACATGAGAATGTAATTGGGCTTCTAGATGTTTTCTCGCCCGCTACCAGTCTAGAAGAATTCAATGACGTGTATCTGGTGACTCACCTGATGGGAGCAGACCTCAACAATATTGTCAAGTGCCAGAAGCTGACAGATGACCACGTCCAGTTCCTCATTTATCAAATCCTACGAGGATTAAAGTACATTCACTCAGCAGACATCATCCACAGAGATCTTAAACCCAGTAACTTGGCTGTAAATGAAGACTGTGAACTTAAGATTTTGGACTTTGGTCTGGCCCGGCTGACTGACGATGAGATGACGGGATATGTTGCCACCCGATGGTACCGTGCCCCAGAGATCATGCTCAACTGGATGCACTACAACATGACAGAGAGAGGCAGTGATCCTAAGGGGAATGAGTCAGCTGGTGTCGGCCCGCTGCCTCCCAATATAAACCAGCTTCAGCAGATAATGCGACTGACGGGAACCCCGCCGGCCTCTCTAATAAGCAGGATGCCGAGCCACGAGGCAAGGAACTACATCAATTCCCTTCCTCATATGCCCAAAAGGAACTTCGCAGATGTGTTTATTGGTGCAAATCCATTAGCTGTGGACCTGCTGGAGAAGATGCTGGTTCTAGACACAGATAAACGGATCACTGCGTCACAGGCTCTCGCGCACCCGTACTTTGCCCAGTATCACGACCCAGATGACGAGCCCGAGGCAGAGCCGTACGACCAGAGCTTCGAGAGTCGCGATCTAGAGATCGACGAGTGGAAACGACTCACGTACGAGGAAGTGGTCAGCTTCGAGCCTCCCATGTTCGACGGAGATGAGATGGAGTCATGAGGAGAATCAGGACCTACAGGACCTTCATCCGTACAGGAAAATGACATTCAAGTGCCTGCCATCATCAAGTGCTGGCTTCCCCTTGTTCTTATCCATGCCTTCATACACGCTCTGTCAAAATAAGAGAAAAAAACATGCAATCTTTCCAAAAGGACACAGAGAATGTAATGTTTTAATCCCCAGTAAAATGGACTACTTTTTTGGCCAGAACACTTACGATTAGAGAAAACTGCACATTCTCATATCAAATTCATATCAGCTTTGTAAACTCACAGTTGCATTTATTATTCTATCTCTGGGGAAGTGAAACATTTACCTCCAAACTCCGCTTGTAGCCTATACAATATATAAAGGCCAGAAAAACTCTGTACTGTCAGAATACTAAGTTTTAGGTATGTAA

Function


symbol description
mapk14a Enables MAP kinase activity. Involved in cellular response to UV; embryonic cleavage; and p38MAPK cascade. Acts upstream of or within regulation of collateral sprouting in absence of injury; regulation of protein stability; and somitogenesis. Predicted to be active in cytoplasm and nucleus. Is expressed in several structures, including digestive system; immature eye; nervous system; otic vesicle; and pronephric duct. Orthologous to human MAPK14 (mitogen-activated protein kinase 14).
mapk14b Predicted to enable MAP kinase activity. Predicted to be involved in several processes, including p38MAPK cascade; positive regulation of cell differentiation; and positive regulation of myoblast fusion. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm and nucleus. Orthologous to human MAPK14 (mitogen-activated protein kinase 14).
mapk14 Enables MAP kinase activity; mitogen-activated protein kinase p38 binding activity; and protein phosphatase binding activity. Involved in several processes, including cellular response to lipoteichoic acid; negative regulation of hippo signaling; and regulation of cytokine production. Acts upstream of or within cellular response to lipopolysaccharide. Located in cytosol and nuclear speck.
p38a Enables MAP kinase activity. Involved in several processes, including defense response to other organism; paracrine signaling; and positive regulation of cell size. Located in nucleus. Is expressed in adult head; embryonic midgut chamber; embryonic primordium of adult hindgut precursor; embryonic/larval midgut; and organism. Orthologous to human MAPK11 (mitogen-activated protein kinase 11).
p38b Enables MAP kinase activity. Involved in several processes, including animal organ morphogenesis; defense response to other organism; and regulation of signal transduction. Predicted to be active in cytoplasm and nucleus. Is expressed in several structures, including embryonic/larval brain; embryonic/larval muscle system; extended germ band embryo; and gut section. Orthologous to several human genes including MAPK14 (mitogen-activated protein kinase 14).

GO:

id name namespace
GO:0090336 positive regulation of brown fat cell differentiation biological_process

KEGG:

id description
K04441 P38; p38 MAP kinase

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000057_01711126_01748095.mRNA True 1518 mRNA 0.48 12 1711126 1748495

Neighbor


gene id symbol gene type direction distance location
CI01000057_01697652_01698656 B3GALT6 coding upstream 12109 1697652 ~ 1699017 (+)
CI01000057_01673559_01688208 HIPK1 coding upstream 21844 1671911 ~ 1689282 (+)
CI01000057_01662304_01670233 NA coding upstream 40546 1660369 ~ 1670580 (+)
CI01000057_01614455_01629013 NA coding upstream 81991 1614455 ~ 1629135 (+)
CI01000057_01553214_01557764 TP53RK coding upstream 153209 1553140 ~ 1557917 (+)
CI01000057_01780001_01798256 SRPK1, SRPK1B coding downstream 31506 1780001 ~ 1798647 (+)
CI01000057_01859686_01900493 KIF21B coding downstream 111191 1859686 ~ 1901066 (+)
CI01000057_01926510_01929865 NA coding downstream 178015 1926510 ~ 1930024 (+)
CI01000057_02043653_02103160 NA coding downstream 295008 2043503 ~ 2103654 (+)
CI01000057_02126499_02142817 TIMELESS, TIMELESSA, TIMELESS.S coding downstream 378004 2126499 ~ 2143124 (+)
G243740 NA non-coding upstream 1650 1704632 ~ 1709476 (+)
G243733 NA non-coding upstream 58135 1582950 ~ 1652991 (+)
G243761 NA non-coding upstream 135574 1575119 ~ 1575552 (+)
G243760 NA non-coding upstream 136869 1574058 ~ 1574257 (+)
G243757 NA non-coding upstream 145407 1565412 ~ 1565719 (+)
G243797 NA non-coding downstream 357202 2105697 ~ 2111516 (+)
G243837 NA non-coding downstream 379995 2128490 ~ 2129226 (+)
CI01000057_02198818_02199189 NA non-coding downstream 450093 2198588 ~ 2199305 (+)
G243850 NA non-coding downstream 460440 2208935 ~ 2209242 (+)
CI01000057_02228717_02239180 NA non-coding downstream 479403 2227799 ~ 2239358 (+)
G243558 NA other upstream 752755 956063 ~ 958371 (+)
G243557 NA other upstream 755931 954843 ~ 955195 (+)
CI01000057_00417827_00418207 NA other upstream 1290616 417700 ~ 418655 (+)
CI01000057_02395285_02396439 NA other downstream 646103 2394598 ~ 2396561 (+)
G243975 NA other downstream 827958 2576453 ~ 2576852 (+)
G243991 NA other downstream 886742 2635237 ~ 2652560 (+)
G245231 NA other downstream 1338601 3087096 ~ 3292562 (+)
G245401 NA other downstream 1789074 3537569 ~ 3538442 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location