CI01000063_02207083_02208978 (MAFF, MAFFL)


Basic Information

Item Value
gene id CI01000063_02207083_02208978
gene name MAFF, MAFFL
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 2207083 ~ 2209144 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000063_02207083_02208978.mRNA
ATGACTTCAGACGGCAGAGCTAGTAAAGCACTCAAGGTGAAGAGGGAATGCGGGGAGAACGTCCCAGTGCTGAGCGACAGTGAGCTCATGTCGCTATCGGTGCGCGAGCTCAACATGCACTTACGCGGTTTGTCACGCGAGGAGGTGCAGAAGTTGAAGCAGAGGCGGCGCACGCTGAAAAACCGCGGCTACGCGGCGAGTTGCCGGGTGAAGCGCGTGTCCCAGCGCGAGGCCCTGGAACAGCAGAAGAAGGAGCTGCAGCGGGAGGTGGAGCGGCTTGGTGCCGAGAACGCAGGCATGAGGCGGGAGCTGGAAGGGCTGGGCGCCCGTCTCGCTGCGCTCCAGCGCTTCGCCAGAGGTTTGGAATCTGGAGGAGGCAGTCTGCTAGCCACCACACCCCGTCTGAACACAGCCTCCGTCATTACCATAGTGAAGACACCGCAGCAGGTGCACAACCCTAGAGAGCAAGGAGCATCCTAGGGCACCACGCTCGCATGGAGACGCAGACACACATAGGTACACAGTATGACCGCGCAGACAGACAGGACCATGTATACTCACATATACAGGAAGAAAAACAAGTACCACTTGGGAATTACAGATTCACTTACATATATAAACACACACAGACTGCATATACAGTCTA

Function

symbol description
maff Enables DNA binding activity and protein heterodimerization activity. Contributes to DNA-binding transcription factor activity. Acts upstream of or within positive regulation of transcription, DNA-templated. Part of transcription regulator complex. Orthologous to human MAFF (MAF bZIP transcription factor F).

GO:

id name namespace
GO:0043565 sequence-specific DNA binding molecular_function

KEGG:

id description
K09037 MAFF_G_K; transcription factor MAFF/G/K

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000063_02207083_02208978.mRNA True 646 mRNA 0.57 2 2207083 2209144

Neighbor

gene id symbol gene type direction distance location
CI01000063_01950136_01991996 SHISA9A coding upstream 214955 1948174 ~ 1992128 (+)
CI01000063_01824468_01849446 NA coding upstream 357629 1822854 ~ 1849454 (+)
CI01000063_01784971_01788682 NA coding upstream 418185 1784971 ~ 1788898 (+)
CI01000063_01739754_01764028 RHBDF1B, RHBDF1, RHBDF1A coding upstream 442311 1739244 ~ 1764772 (+)
CI01000063_01692878_01697954 NA coding upstream 509005 1692394 ~ 1698078 (+)
CI01000063_02259693_02263566 NA coding downstream 50335 2259479 ~ 2263765 (+)
CI01000063_02287935_02290399 NA coding downstream 77197 2286341 ~ 2291640 (+)
CI01000063_02329534_02344024 ZC3H7B coding downstream 120390 2329534 ~ 2344971 (+)
CI01000063_02350026_02353930 TEFA coding downstream 140882 2350026 ~ 2354112 (+)
CI01000063_02362425_02374879 ACO2 coding downstream 153281 2362425 ~ 2374987 (+)
G262359 NA non-coding upstream 3513 2199765 ~ 2203570 (+)
G262540 NA non-coding upstream 167877 2038984 ~ 2039206 (+)
G262538 NA non-coding upstream 171038 2035833 ~ 2036045 (+)
G262537 NA non-coding upstream 171744 2035121 ~ 2035339 (+)
G262536 NA non-coding upstream 172688 2033972 ~ 2034395 (+)
G262362 NA non-coding downstream 12604 2221748 ~ 2223893 (+)
G262397 NA non-coding downstream 28537 2237681 ~ 2237885 (+)
G262440 NA non-coding downstream 29531 2238675 ~ 2239407 (+)
G262623 NA non-coding downstream 31192 2240336 ~ 2240678 (+)
G262624 NA non-coding downstream 34056 2243200 ~ 2243546 (+)
G262194 NA other upstream 1062076 1139352 ~ 1145007 (+)
G262060 NA other upstream 1496529 710110 ~ 710554 (+)
G261984 NA other upstream 1539701 665800 ~ 667382 (+)
CI01000063_00533801_00557577 MPP3B other upstream 1648749 533801 ~ 558334 (+)
G261700 NA other upstream 1932633 252412 ~ 274450 (+)
G262423 NA other downstream 32264 2241408 ~ 2242965 (+)
G262436 NA other downstream 504471 2713615 ~ 2714517 (+)
G265391 NA other downstream 3704639 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 4126134 6335618 ~ 6338283 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_005316 maff coding NC_007123.7 CM002896.2 19340786 ~ 19346678 (-)