G418081


Basic Information

Item Value
gene id G418081
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 601112 ~ 601378 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480246
AACAGAAAATGGGCAAAGAGGTGGGACGTGGGTAGAGCTGAGGTGACATGACGGCAGCAGATAAACGGCTAGTGGTGAGAGCAGTGGCAATCCACCTGTCACTCAAGTGGCCGCGCCCTTAATTATGCAGAACTTTAAGGCTTAATATAATTTAAACGGATGAGTTATAAAGAAAATTCACCCCCCTCACAGTCATGAAGGGCAAAATTAGCTATATAGACCAAAACCACAATTTGTACCAGGCTGTAAACATTTTCTGCTGTAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480246 True 267 lncRNA 0.44 1 601112 601378

Neighbor

gene id symbol gene type direction distance location
CI01000304_00480135_00531529 NA coding upstream 69075 479781 ~ 532037 (+)
CI01000304_00453663_00453991 CTXN3 coding upstream 145872 453663 ~ 455240 (+)
CI01000304_00424703_00434890 PRRC1 coding upstream 166046 424703 ~ 435066 (+)
CI01000304_00370333_00419672 MEGF10 coding upstream 180357 370333 ~ 420755 (+)
CI01000304_00315935_00342330 LMNB1 coding upstream 258589 314742 ~ 342531 (+)
CI01000304_00695426_00725459 SLC27A6 coding downstream 93083 694461 ~ 725459 (+)
CI01000304_00728178_00731945 ISOC1, ISOC1.L coding downstream 126578 727956 ~ 732274 (+)
CI01000304_00757894_00760456 NA coding downstream 156516 757894 ~ 760660 (+)
CI01000304_00772995_00827316 CHSY3 coding downstream 169655 771033 ~ 827608 (+)
CI01000304_00846138_00850133 NA coding downstream 244681 846059 ~ 850379 (+)
G418079 NA non-coding upstream 359 600540 ~ 600753 (+)
G418077 NA non-coding upstream 3449 597286 ~ 597663 (+)
G418058 NA non-coding upstream 43320 557591 ~ 557792 (+)
G418003 NA non-coding upstream 49131 550273 ~ 551981 (+)
G418004 NA non-coding upstream 74590 521684 ~ 526522 (+)
G418083 NA non-coding downstream 1715 603093 ~ 603478 (+)
G418085 NA non-coding downstream 3256 604634 ~ 604845 (+)
G418086 NA non-coding downstream 3887 605265 ~ 605572 (+)
G418088 NA non-coding downstream 5263 606641 ~ 606958 (+)
G418089 NA non-coding downstream 17227 618605 ~ 618901 (+)
G418059 NA other upstream 36661 558092 ~ 564451 (+)
G417987 NA other upstream 373259 226703 ~ 227853 (+)
G418116 NA other downstream 271292 872670 ~ 875249 (+)
G418981 NA other downstream 1491116 2092494 ~ 2093678 (+)
G420445 NA other downstream 3701958 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 4571845 5173426 ~ 5176791 (+)
G421162 NA other downstream 5639855 6241233 ~ 6242997 (+)

Expression


Co-expression Network