G422918


Basic Information

Item Value
gene id G422918
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 7928969 ~ 7929506 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU485712
GAAGCCCAAAAAAATGCATCCATCCATCATAAAAATAATTAATATGTTGGTTAATAAATGCCTTCTGAAGTGAAGTGATGCATTTTTGTTTTTAGCTAAAACGAATAGCTTCCGGCAGATGACCGTAAGCACACTGCGCAAGTCGACTTGCACAACAAGAGTAACCCGTGACGCGATGTATGACGCAGGATGTAGGAGTATAGTAAGCTTAGACGCGGTTTAAACAAATAGGGCTGTGCAACAAACTCATGCTCCTCTTCGCTTATATCGAAATCCTTCGACATTTCTCCTTAAAATTTCTTGTTTTAGACTTCTAATTTGTGACCGGTGTTTTGTTTCGCTCTATCCTCTGTGCTTCCGCGTTTGTCATTGTGCCACGCGTTGGGTCAGGGGTTACTCTTCCGCCGCAAATCGAAGCTTAATAAAGATTTAAATATGGATATTTTTCTTACAAAAACCCATCGCTTCACTTCAGAAGGCCTTTATTAACCCCCTGGAGCCGTATGGATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU485712 True 512 lncRNA 0.41 2 7928969 7929506

Neighbor

gene id symbol gene type direction distance location
CI01000304_07612069_07709665 NA coding downstream 219304 7612069 ~ 7709665 (-)
CI01000304_07464639_07466430 NA coding downstream 462539 7464235 ~ 7466430 (-)
CI01000304_07325899_07328203 NA coding downstream 600766 7325648 ~ 7328203 (-)
CI01000304_07303509_07309222 STARD7 coding downstream 617258 7302824 ~ 7311711 (-)
CI01000304_07282197_07285838 NA coding downstream 643131 7281481 ~ 7285838 (-)
CI01000304_07961608_07968820 NA coding upstream 32059 7961565 ~ 7968949 (-)
CI01000304_08165245_08217042 NA coding upstream 235691 8165197 ~ 8217042 (-)
CI01000304_08218405_08218927 NA coding upstream 288128 8217634 ~ 8218927 (-)
CI01000304_08329095_08386362 GFRA2B, GFRA2 coding upstream 399589 8329095 ~ 8386362 (-)
CI01000304_08510508_08532975 NA coding upstream 580964 8510470 ~ 8533026 (-)
G422841 NA non-coding downstream 9179 7916488 ~ 7919790 (-)
G422846 NA non-coding downstream 14016 7913434 ~ 7914953 (-)
G422843 NA non-coding downstream 26206 7901473 ~ 7902763 (-)
G422895 NA non-coding downstream 94902 7833792 ~ 7834067 (-)
G422840 NA non-coding downstream 177322 7751271 ~ 7751647 (-)
G422920 NA non-coding upstream 32864 7962370 ~ 7962729 (-)
G422931 NA non-coding upstream 40982 7970488 ~ 7970694 (-)
G422933 NA non-coding upstream 46437 7975943 ~ 7976391 (-)
G422935 NA non-coding upstream 52224 7981730 ~ 7981941 (-)
G422939 NA non-coding upstream 72894 8002400 ~ 8004601 (-)
G422810 NA other downstream 276266 7630159 ~ 7652703 (-)
G422378 NA other downstream 1145923 6744679 ~ 6783046 (-)
G422354 NA other downstream 1297470 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 1445474 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 3256022 4661766 ~ 4672947 (-)
G423386 NA other upstream 932717 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 1638850 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 1807240 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 2223940 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 2261068 10190574 ~ 10192357 (-)

Expression


Co-expression Network