G423529



Basic Information


Item Value
gene id G423529
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 8478182 ~ 8478664 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU486380
ATTTTATTTAATATTTTATCCAGTTTCTGCCAATCTCATGTTAATCTTGAGTACCTAAAGAGTAGTAGTGCCTCTTCATATCGCTGAAAAGTCTTTAGTTTTATTATATTTATAAAAGATACATACGCTGTACCGAGTCTTTCCGAAAACAGCCGAGCGCCTGGAGGCGTGCCGTGTGAGCGGAGCTAAAGAGTGACGAGAACGCGCAGCTTTTGCGTAGTGATCATCTGCAAGCTATGAATGGTCAGCAAAACAACTATATTTAAACACACACAATACACCATCGCATTATCCCTGGATAACTTTTGAATCACTATAACGAATATAGCGTATAGTGAGGAGGTGGTGATGGTGGTGGTGGAGGAGGTGTTGTTGTTGTTGTTGTTGTTGTTATTGAGTTTATTAGTAAAGTCAGTTGTTTATTCATCTTCGTCATGTGAGTTTCTACTACAAAGCCTTTACGCTGTGACACCTCTACATTAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU486380 True 483 lncRNA 0.39 1 8478182 8478664

Neighbor


gene id symbol gene type direction distance location
CI01000304_08329095_08386362 GFRA2B, GFRA2 coding downstream 91820 8329095 ~ 8386362 (-)
CI01000304_08218405_08218927 NA coding downstream 259255 8217634 ~ 8218927 (-)
CI01000304_08165245_08217042 NA coding downstream 261140 8165197 ~ 8217042 (-)
CI01000304_07961608_07968820 NA coding downstream 509233 7961565 ~ 7968949 (-)
CI01000304_07612069_07709665 NA coding downstream 768517 7612069 ~ 7709665 (-)
CI01000304_08510508_08532975 NA coding upstream 31806 8510470 ~ 8533026 (-)
CI01000304_08567281_08570808 PBDC1 coding upstream 88530 8567194 ~ 8570808 (-)
CI01000304_08605819_08615439 HTR7B coding upstream 126211 8604875 ~ 8617967 (-)
CI01000304_08680653_08681838 NA coding upstream 201467 8680131 ~ 8682389 (-)
CI01000304_08692093_08712203 NA coding upstream 213295 8691959 ~ 8712203 (-)
G423524 NA non-coding downstream 4306 8473674 ~ 8473876 (-)
G423521 NA non-coding downstream 10910 8467040 ~ 8467272 (-)
G423516 NA non-coding downstream 21401 8456446 ~ 8456781 (-)
G423501 NA non-coding downstream 42580 8435266 ~ 8435602 (-)
G423496 NA non-coding downstream 51151 8426823 ~ 8427031 (-)
G423551 NA non-coding upstream 35242 8513906 ~ 8514241 (-)
G423557 NA non-coding upstream 63796 8542460 ~ 8542686 (-)
G423588 NA non-coding upstream 193134 8671798 ~ 8672580 (-)
G423589 NA non-coding upstream 194012 8672676 ~ 8673012 (-)
G423615 NA non-coding upstream 470380 8949044 ~ 8949311 (-)
G422810 NA other downstream 825479 7630159 ~ 7652703 (-)
G422378 NA other downstream 1695136 6744679 ~ 6783046 (-)
G422354 NA other downstream 1846683 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 1994687 6480743 ~ 6483986 (-)
CI01000304_04661808_04672936 PPWD1 other downstream 3805235 4661766 ~ 4672947 (-)
G423386 NA other upstream 383559 8862223 ~ 8865296 (-)
CI01000304_09566730_09575706 NA other upstream 1089692 9566730 ~ 9575706 (-)
CI01000304_09737662_09738777 NA other upstream 1258082 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 1674782 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 1711910 10190574 ~ 10192357 (-)

Expression



Co-expression Network