G679080


Basic Information

Item Value
gene id G679080
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 1808882 ~ 1809140 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799774
CTTTGTCCAAGGTGCCATGATTGTCTATGAGGACATCGATATATTTTGAAAAACATGTCCGCCATCGGCCAATGAATGTGCCTTCACATTTTTCAAATGCGCGTGTATACACGACATTCGTACCACATGGTAGAACTCCTCATTCTGAGCAACTTTGCCTCTAGGACCGCCGCTGTCCATCTAATCGTTCGTTAAATATTGGAGATTATTTCAAAAACCAACTTTGGCGAACTAGTCCTAGGTTTTTGGCTCAACCTCG

Function

NR:

description
cilia- and flagella-associated protein 206-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU799774 True 259 lncRNA 0.43 1 1808882 1809140

Neighbor

gene id symbol gene type direction distance location
CI01180000_01747067_01755038 GPR137B coding upstream 53625 1747067 ~ 1755257 (+)
CI01180000_01576739_01578505 GNG4 coding upstream 229476 1576739 ~ 1579406 (+)
CI01180000_01542059_01545609 GGPS1 coding upstream 262802 1542059 ~ 1546080 (+)
CI01180000_01492241_01493781 NA coding upstream 314436 1491671 ~ 1494446 (+)
CI01180000_01380859_01385445 NA coding upstream 423099 1380701 ~ 1385783 (+)
CI01180000_01828938_01830221 DNAJC12 coding downstream 19798 1828938 ~ 1830814 (+)
CI01180000_01832263_01834405 COX5B.2, COX5B2, COX5B coding downstream 22873 1832013 ~ 1834999 (+)
CI01180000_01865632_01870994 NA coding downstream 56369 1865509 ~ 1871089 (+)
CI01180000_01915282_01926129 NA coding downstream 105752 1914892 ~ 1926269 (+)
CI01180000_01942458_01949580 NA coding downstream 132987 1942127 ~ 1950647 (+)
G679077 NA non-coding upstream 827 1803405 ~ 1808055 (+)
G679072 NA non-coding upstream 29184 1778590 ~ 1779698 (+)
G679052 NA non-coding upstream 31757 1776710 ~ 1777125 (+)
G679069 NA non-coding upstream 43344 1765310 ~ 1765538 (+)
G679064 NA non-coding upstream 73121 1735417 ~ 1735761 (+)
G679160 NA non-coding downstream 221598 2030738 ~ 2031031 (+)
G679165 NA non-coding downstream 242387 2051527 ~ 2061011 (+)
G679202 NA non-coding downstream 289401 2098541 ~ 2098808 (+)
G679204 NA non-coding downstream 290558 2099698 ~ 2106093 (+)
G679050 NA non-coding downstream 312129 2121269 ~ 2127987 (+)
G679076 NA other upstream 9449 1795170 ~ 1799433 (+)
G678946 NA other upstream 252731 1518353 ~ 1612547 (+)
G678637 NA other upstream 653210 1149551 ~ 1155672 (+)
G678751 NA other upstream 742791 1059843 ~ 1066091 (+)
G678440 NA other upstream 1657230 147934 ~ 151652 (+)
G679324 NA other downstream 579727 2388867 ~ 2397360 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other downstream 880622 2689271 ~ 2693221 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other downstream 1744137 3569165 ~ 3573135 (+)
G680736 NA other downstream 1956551 3765691 ~ 3784441 (+)
G681137 NA other downstream 2974165 4783305 ~ 4785631 (+)

Expression


Co-expression Network