G681521


Basic Information

Item Value
gene id G681521
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 6207092 ~ 6208009 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU802470
TGTGCTGAAGTATTCTTGGCCACTCCTTACCTTGGGAATTAGCCTGCAAGACCCCAATGCTGTCATCAAACTGCATAGATTTGATGTTAAGAGACGCCAAGATGCATTCCTTGTCCTGCAGTGAAGCATCGTCGATATTGTTCTGATTGGCTGACAGGATAACGCACATGTCGCAGAGGTTGATGTTGACGGCCCTTAAATCAGCTCGACTTAATGGCGTACCAGGTAAGATGGAGACTTTAGGGAAGTTGTGAAGGGTTTCCCACTCTCTTCTTAGATAATCTAACGAGCCCACAAACACAATGGGCTTTAGCTCATGGTAATGGAAGTTGCTTGCTCTTAAAGGCATCACCAAGTTTCGAAGCCCCACTAAAGCTGACGTGACATCTCCGAATATACAGACTACTACATGTCCACTTAAAACCGTCATGGAGGCCTCACTGCGTGTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU802470 True 450 lncRNA 0.46 2 6207092 6208009

Neighbor

gene id symbol gene type direction distance location
CI01180000_06183820_06187700 NA coding upstream 19191 6182149 ~ 6187901 (+)
CI01180000_06060886_06073483 NA coding upstream 132870 6059381 ~ 6074222 (+)
CI01180000_05928275_05933064 NA coding upstream 273840 5927492 ~ 5945665 (+)
CI01180000_05919195_05919836 NA coding upstream 286645 5918105 ~ 5920447 (+)
CI01180000_05875768_05878028 NA coding upstream 328373 5875069 ~ 5878719 (+)
CI01180000_06369051_06375352 NA coding downstream 160372 6368381 ~ 6377253 (+)
CI01180000_06503211_06517041 NA coding downstream 295202 6503211 ~ 6517102 (+)
CI01180000_06532667_06556697 VWC2 coding downstream 324267 6532276 ~ 6557504 (+)
CI01180000_06581704_06589445 NA coding downstream 372981 6580990 ~ 6589481 (+)
CI01180000_06608734_06626459 IKAROS, IKZF1 coding downstream 400725 6608734 ~ 6626812 (+)
G681506 NA non-coding upstream 27171 6179672 ~ 6179921 (+)
G681459 NA non-coding upstream 360210 5846662 ~ 5846882 (+)
G681451 NA non-coding upstream 376001 5830647 ~ 5831091 (+)
G681440 NA non-coding upstream 404169 5802712 ~ 5802923 (+)
G681537 NA non-coding downstream 50800 6258809 ~ 6262932 (+)
G681540 NA non-coding downstream 62141 6270150 ~ 6383813 (+)
G681606 NA non-coding downstream 189509 6397518 ~ 6403932 (+)
G681591 NA non-coding downstream 234294 6442303 ~ 6467224 (+)
G681592 NA non-coding downstream 263986 6471995 ~ 6478999 (+)
G681268 NA other upstream 833330 5370410 ~ 5373762 (+)
G681137 NA other upstream 1421461 4783305 ~ 4785631 (+)
G680736 NA other upstream 2422651 3765691 ~ 3784441 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other upstream 2634695 3569165 ~ 3573135 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other upstream 3511656 2689271 ~ 2693221 (+)
G681686 NA other downstream 424899 6632908 ~ 6634989 (+)
G681667 NA other downstream 447837 6655846 ~ 6659546 (+)
CI01180000_07403482_07412752 HELLS other downstream 1195138 7403482 ~ 7413190 (+)
CI01180000_07694615_07695428 MRPL14 other downstream 1455414 7694529 ~ 7695667 (+)

Expression


Co-expression Network