XLOC_024313 (zgc:171759)


Basic Information

Item Value
gene id XLOC_024313
gene name zgc:171759
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36333993 ~ 36334367 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00048126
ATGCCTGAGCCAGCAAAGACTGCGCCCAAGAAGGGCTCCAAGAAAGCCGTTACCAAGACCGCCGGCAAAAGCGGCAAGAAACGTAGAAGGACTAGGAAGGAAAGCTACGCTATCTACGTGTACAAAGTGTTGAAGCAGGTCCATCCCGACACTGGTATCTCCTCCAAGGCGATGGGCATCATGAACTCGTTCGTCAACGACATCTTCGAGCGCATCGCCGGTGAGGCTTCTCGTCTCGCTCACTACAACAAGCGCTCCACCATCACTTCCAGAGAGATCCAGACCGCCGTGCGTCTGCTGCTGCCCGGTGAGCTGGCCAAACACGCCGTGTCTGAGGGCACAAAGGCCGTCACCAAGTACACCAGCTCCAAGTAA

Function

symbol description
zgc:171759 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000109737

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00048126 True 375 mRNA 0.56 1 36333993 36334367

Neighbor

gene id symbol gene type direction distance location
XLOC_024312 hist1h4l coding upstream 900 36332782 ~ 36333093 (+)
XLOC_024311 zgc:173552 coding upstream 3960 36329623 ~ 36330033 (+)
XLOC_024310 hist1h2a4 coding upstream 4988 36328524 ~ 36329005 (+)
XLOC_024309 si:ch211-113a14.12 coding upstream 6089 36327034 ~ 36327904 (+)
XLOC_024308 hist1h4l coding upstream 7889 36325793 ~ 36326104 (+)
XLOC_024314 hist1h2a1 coding downstream 2553 36336920 ~ 36337306 (+)
XLOC_024315 hist1h4l coding downstream 3922 36338289 ~ 36338600 (+)
XLOC_024316 si:ch211-113a14.18 coding downstream 5500 36339867 ~ 36340516 (+)
XLOC_024317 si:ch211-113a14.19 coding downstream 6989 36341356 ~ 36341742 (+)
XLOC_024318 zgc:173552 coding downstream 8508 36342875 ~ 36343285 (+)
XLOC_023973 CR762411.1 misc upstream 21115884 15217824 ~ 15218109 (+)
XLOC_024301 NA non-coding upstream 60406 36269642 ~ 36273587 (+)
XLOC_024299 CABZ01089081.1 non-coding upstream 233284 36096364 ~ 36100709 (+)
XLOC_024296 NA non-coding upstream 318557 35988910 ~ 36015436 (+)
XLOC_024297 NA non-coding upstream 318831 36011421 ~ 36015162 (+)
XLOC_024292 BX957352.1 non-coding upstream 452462 35881415 ~ 35881531 (+)
XLOC_024323 NA non-coding downstream 41769 36376136 ~ 36383338 (+)
XLOC_024324 NA non-coding downstream 64145 36398512 ~ 36404040 (+)
XLOC_024326 NA non-coding downstream 114217 36448584 ~ 36451721 (+)
XLOC_024327 FO904923.1 non-coding downstream 122433 36456800 ~ 36456918 (+)
XLOC_024328 CABZ01088576.1 non-coding downstream 175307 36509674 ~ 36509789 (+)

Expression


Co-expression Network