XLOC_024318 (zgc:173552)


Basic Information

Item Value
gene id XLOC_024318
gene name zgc:173552
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36342875 ~ 36343285 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00048131
ATGGCAAGAACCAAGCAGACCGCCCGTAAATCCACTGGAGGCAAAGCTCCAAGGAAGCAGCTCGCCACTAAGGCCGCTCGTAAGAGCGCTCCGGCTACCGGCGGCGTCAAGAAGCCTCACCGTTACAGGCCCGGAACCGTGGCTCTGAGAGAGATCCGCCGCTACCAGAAGTCCACTGAGCTGCTGATCCGCAAACTGCCCTTCCAGCGTCTGGTCCGAGAAATCGCTCAGGATTTCAAGACTGATCTGCGCTTCCAGAGCTCCGCCGTCATGGCTCTTCAGGAGTCCAGCGAAGCTTATCTGGTCGGTCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAAGACATCCAGCTGGCCCGCCGCATCCGCGGAGAGCGCGCTTAA

Function

symbol description
zgc:173552 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome. Predicted to be part of nucleosome. Predicted to be active in nucleus.

GO:

id name namespace
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-080220-24 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome. Predicted to be part of nucleosome. Predicted to be active in nucleus.

Ensembl:

ensembl_id ENSDARG00000112131

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00048131 True 411 mRNA 0.60 1 36342875 36343285

Neighbor

gene id symbol gene type direction distance location
XLOC_024317 si:ch211-113a14.19 coding upstream 1133 36341356 ~ 36341742 (+)
XLOC_024316 si:ch211-113a14.18 coding upstream 2359 36339867 ~ 36340516 (+)
XLOC_024315 hist1h4l coding upstream 4275 36338289 ~ 36338600 (+)
XLOC_024314 hist1h2a1 coding upstream 5569 36336920 ~ 36337306 (+)
XLOC_024313 zgc:171759 coding upstream 8508 36333993 ~ 36334367 (+)
XLOC_024319 hist1h4l coding downstream 2582 36345867 ~ 36346178 (+)
XLOC_024320 si:ch211-113a14.22 coding downstream 3841 36347126 ~ 36347500 (+)
XLOC_024321 hist1h2a3 coding downstream 5116 36348401 ~ 36349012 (+)
XLOC_024322 zgc:173552 coding downstream 6289 36349574 ~ 36349984 (+)
XLOC_024323 NA coding downstream 32851 36376136 ~ 36383338 (+)
XLOC_023973 CR762411.1 misc upstream 21124766 15217824 ~ 15218109 (+)
XLOC_024301 NA non-coding upstream 69288 36269642 ~ 36273587 (+)
XLOC_024299 CABZ01089081.1 non-coding upstream 242166 36096364 ~ 36100709 (+)
XLOC_024296 NA non-coding upstream 327439 35988910 ~ 36015436 (+)
XLOC_024297 NA non-coding upstream 327713 36011421 ~ 36015162 (+)
XLOC_024292 BX957352.1 non-coding upstream 461344 35881415 ~ 35881531 (+)
XLOC_024324 NA non-coding downstream 55227 36398512 ~ 36404040 (+)
XLOC_024326 NA non-coding downstream 105299 36448584 ~ 36451721 (+)
XLOC_024327 FO904923.1 non-coding downstream 113515 36456800 ~ 36456918 (+)
XLOC_024328 CABZ01088576.1 non-coding downstream 166389 36509674 ~ 36509789 (+)

Expression


Co-expression Network