XLOC_024319 (hist1h4l)


Basic Information

Item Value
gene id XLOC_024319
gene name hist1h4l
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36345867 ~ 36346178 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00048132
ATGTCTGGAAGAGGCAAAGGCGGTAAAGGACTCGGAAAAGGAGGTGCTAAGCGTCACCGTAAAGTTCTCCGTGATAACATCCAGGGAATCACCAAGCCCGCTATCCGCCGTCTCGCTCGTCGTGGTGGTGTGAAGCGTATCTCTGGTCTGATCTACGAGGAGACTCGCGGAGTGTTGAAGGTGTTCCTGGAGAACGTCATCCGTGATGCCGTCACCTACACCGAGCACGCCAAGAGGAAGACCGTGACCGCCATGGATGTTGTGTACGCGCTGAAGAGACAGGGACGCACTCTGTACGGCTTCGGCGGTTAA

Function

symbol description
hist1h4l Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

GO:

id name namespace
GO:0006352 DNA-templated transcription, initiation biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070927-10 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

Ensembl:

ensembl_id ENSDARG00000112491

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00048132 True 312 mRNA 0.56 1 36345867 36346178

Neighbor

gene id symbol gene type direction distance location
XLOC_024318 zgc:173552 coding upstream 2582 36342875 ~ 36343285 (+)
XLOC_024317 si:ch211-113a14.19 coding upstream 4125 36341356 ~ 36341742 (+)
XLOC_024316 si:ch211-113a14.18 coding upstream 5351 36339867 ~ 36340516 (+)
XLOC_024315 hist1h4l coding upstream 7267 36338289 ~ 36338600 (+)
XLOC_024314 hist1h2a1 coding upstream 8561 36336920 ~ 36337306 (+)
XLOC_024320 si:ch211-113a14.22 coding downstream 948 36347126 ~ 36347500 (+)
XLOC_024321 hist1h2a3 coding downstream 2223 36348401 ~ 36349012 (+)
XLOC_024322 zgc:173552 coding downstream 3396 36349574 ~ 36349984 (+)
XLOC_024323 NA coding downstream 29958 36376136 ~ 36383338 (+)
XLOC_024324 NA coding downstream 52334 36398512 ~ 36404040 (+)
XLOC_023973 CR762411.1 misc upstream 21127758 15217824 ~ 15218109 (+)
XLOC_024301 NA non-coding upstream 72280 36269642 ~ 36273587 (+)
XLOC_024299 CABZ01089081.1 non-coding upstream 245158 36096364 ~ 36100709 (+)
XLOC_024296 NA non-coding upstream 330431 35988910 ~ 36015436 (+)
XLOC_024297 NA non-coding upstream 330705 36011421 ~ 36015162 (+)
XLOC_024292 BX957352.1 non-coding upstream 464336 35881415 ~ 35881531 (+)
XLOC_024326 NA non-coding downstream 102406 36448584 ~ 36451721 (+)
XLOC_024327 FO904923.1 non-coding downstream 110622 36456800 ~ 36456918 (+)
XLOC_024328 CABZ01088576.1 non-coding downstream 163496 36509674 ~ 36509789 (+)

Expression


Co-expression Network