XLOC_024320 (si:ch211-113a14.22)


Basic Information

Item Value
gene id XLOC_024320
gene name si:ch211-113a14.22
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36347126 ~ 36347500 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00048133
ATGCCTGAGCCAGCAAAGCCCGCGCCCAAGAAGGGATCTAAGAAAGCGGTCACCAAGACCGCTGGAAAAGGAGGAAAGAAGCGCAAGAGGACCAGGAAGGAAAGCTACGCTATCTACGTCTACAAGGTGTTGAAGCAGGTTCATCCCGACACTGGTATCTCCTCCAAGGCGATGGGCATCATGAACTCGTTCGTCAACGACATCTTCGAGCGCATCGCCGGTGAGGCTTCACGTCTCGCTCACTACAACAAGCGCTCCACCATCACTTCCAGAGAGATCCAGACCGCCGTGCGTCTGCTGCTGCCCGGTGAGCTGGCCAAACACGCCGTGTCTGAGGGCACCAAGGCTGTGACCAAGTACACCAGCTCCAAGTAA

Function

symbol description
si:ch211-113a14.22 Predicted to enable DNA binding activity. Predicted to be involved in nucleosome assembly. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome.

GO:

id name namespace
GO:0006334 nucleosome assembly biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-121214-203 Predicted to enable DNA binding activity. Predicted to be involved in nucleosome assembly. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome.

Ensembl:

ensembl_id ENSDARG00000114895

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00048133 True 375 mRNA 0.57 1 36347126 36347500

Neighbor

gene id symbol gene type direction distance location
XLOC_024319 hist1h4l coding upstream 948 36345867 ~ 36346178 (+)
XLOC_024318 zgc:173552 coding upstream 3841 36342875 ~ 36343285 (+)
XLOC_024317 si:ch211-113a14.19 coding upstream 5384 36341356 ~ 36341742 (+)
XLOC_024316 si:ch211-113a14.18 coding upstream 6610 36339867 ~ 36340516 (+)
XLOC_024315 hist1h4l coding upstream 8526 36338289 ~ 36338600 (+)
XLOC_024321 hist1h2a3 coding downstream 901 36348401 ~ 36349012 (+)
XLOC_024322 zgc:173552 coding downstream 2074 36349574 ~ 36349984 (+)
XLOC_024323 NA coding downstream 28636 36376136 ~ 36383338 (+)
XLOC_024324 NA coding downstream 51012 36398512 ~ 36404040 (+)
XLOC_024325 ankrd27 coding downstream 57521 36405021 ~ 36437925 (+)
XLOC_023973 CR762411.1 misc upstream 21129017 15217824 ~ 15218109 (+)
XLOC_024301 NA non-coding upstream 73539 36269642 ~ 36273587 (+)
XLOC_024299 CABZ01089081.1 non-coding upstream 246417 36096364 ~ 36100709 (+)
XLOC_024296 NA non-coding upstream 331690 35988910 ~ 36015436 (+)
XLOC_024297 NA non-coding upstream 331964 36011421 ~ 36015162 (+)
XLOC_024292 BX957352.1 non-coding upstream 465595 35881415 ~ 35881531 (+)
XLOC_024326 NA non-coding downstream 101084 36448584 ~ 36451721 (+)
XLOC_024327 FO904923.1 non-coding downstream 109300 36456800 ~ 36456918 (+)
XLOC_024328 CABZ01088576.1 non-coding downstream 162174 36509674 ~ 36509789 (+)

Expression


Co-expression Network