RNA id: TCONS_00048132


Basic Information

Item Value
RNA id TCONS_00048132
length 312
RNA type mRNA
GC content 0.56
exon number 1
gene id XLOC_024319
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36345867 ~ 36346178 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTCTGGAAGAGGCAAAGGCGGTAAAGGACTCGGAAAAGGAGGTGCTAAGCGTCACCGTAAAGTTCTCCGTGATAACATCCAGGGAATCACCAAGCCCGCTATCCGCCGTCTCGCTCGTCGTGGTGGTGTGAAGCGTATCTCTGGTCTGATCTACGAGGAGACTCGCGGAGTGTTGAAGGTGTTCCTGGAGAACGTCATCCGTGATGCCGTCACCTACACCGAGCACGCCAAGAGGAAGACCGTGACCGCCATGGATGTTGTGTACGCGCTGAAGAGACAGGGACGCACTCTGTACGGCTTCGGCGGTTAA

Function

GO:

id name namespace
GO:0006352 DNA-templated transcription, initiation biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070927-10 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

Ensembl:

ensembl_id ENSDART00000186527

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00048116 lncRNA upstream 42841 36300651 ~ 36303026 (+) True XLOC_024303
TCONS_00049287 lncRNA upstream 72280 36269642 ~ 36273587 (+) True XLOC_024301
TCONS_00048111 lncRNA upstream 245158 36096364 ~ 36100709 (+) True XLOC_024299
TCONS_00049285 lncRNA upstream 330431 35988910 ~ 36015436 (+) True XLOC_024296
TCONS_00049288 lncRNA downstream 29958 36376136 ~ 36383338 (+) True XLOC_024323
TCONS_00049289 lncRNA downstream 52334 36398512 ~ 36404040 (+) True XLOC_024324
TCONS_00048138 lncRNA downstream 72599 36418777 ~ 36421945 (+) True XLOC_024325
TCONS_00049290 lncRNA downstream 102406 36448584 ~ 36451721 (+) False XLOC_024326
TCONS_00049291 lncRNA downstream 102776 36448954 ~ 36451721 (+) False XLOC_024326
TCONS_00048131 mRNA upstream 2582 36342875 ~ 36343285 (+) True XLOC_024318
TCONS_00048130 mRNA upstream 4125 36341356 ~ 36341742 (+) True XLOC_024317
TCONS_00048129 mRNA upstream 5351 36339867 ~ 36340516 (+) True XLOC_024316
TCONS_00048128 mRNA upstream 7267 36338289 ~ 36338600 (+) True XLOC_024315
TCONS_00048127 mRNA upstream 8561 36336920 ~ 36337306 (+) True XLOC_024314
TCONS_00048133 mRNA downstream 948 36347126 ~ 36347500 (+) True XLOC_024320
TCONS_00048134 mRNA downstream 2223 36348401 ~ 36349012 (+) True XLOC_024321
TCONS_00048135 mRNA downstream 3396 36349574 ~ 36349984 (+) True XLOC_024322
TCONS_00048136 mRNA downstream 58843 36405021 ~ 36428603 (+) False XLOC_024325
TCONS_00048137 mRNA downstream 65446 36411624 ~ 36437925 (+) False XLOC_024325
TCONS_00048100 other upstream 464336 35881415 ~ 35881531 (+) True XLOC_024292
TCONS_00048053 other upstream 1554401 34791362 ~ 34791466 (+) True XLOC_024254
TCONS_00048052 other upstream 1556248 34775558 ~ 34789619 (+) True XLOC_024253
TCONS_00048029 other upstream 2565239 33780513 ~ 33780628 (+) True XLOC_024239
TCONS_00048028 other upstream 2616469 33729284 ~ 33729398 (+) True XLOC_024238
TCONS_00048139 other downstream 110622 36456800 ~ 36456918 (+) True XLOC_024327
TCONS_00048140 other downstream 163496 36509674 ~ 36509789 (+) True XLOC_024328
TCONS_00048142 other downstream 497949 36844127 ~ 36844249 (+) True XLOC_024331
TCONS_00048157 other downstream 1020520 37366698 ~ 37366955 (+) False XLOC_024341
TCONS_00048162 other downstream 1089183 37435361 ~ 37439792 (+) False XLOC_024342

Expression Profile

//