RNA id: TCONS_00048127


Basic Information

Item Value
RNA id TCONS_00048127
length 387
RNA type mRNA
GC content 0.58
exon number 1
gene id XLOC_024314
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36336920 ~ 36337306 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAGCGGAAGAGGCAAAACCGGTGGCAAGGCTAGAGCAAAGGCGAAGTCTCGCTCATCCAGGGCTGGTCTTCAGTTTCCCGTTGGCCGTATTCACAGACTGCTCCGTAAGGGTAACTATGCTCAGCGTGTTGGTGCCGGTGCTCCAGTCTACTTGGCCGCTGTGCTCGAGTATCTGACCGCTGAAATCCTGGAGTTGGCCGGAAACGCCGCTCGGGACAACAAGAAGACCCGCATCATCCCCCGTCACCTGCAGCTGGCGGTGCGCAACGACGAGGAGTTGAACAAGCTTCTGGGTGGAGTGACCATCGCTCAGGGCGGTGTGCTGCCCAACATCCAGGCCGTGCTGCTGCCTAAGAAGACCGAGAAGGCTGCCAAAGGCAAATAA

Function

GO:

id name namespace
GO:0051673 membrane disruption in other organism biological_process
GO:0045087 innate immune response biological_process
GO:0006325 chromatin organization biological_process
GO:0006342 chromatin silencing biological_process
GO:0050830 defense response to Gram-positive bacterium biological_process
GO:0000786 nucleosome cellular_component
GO:0005615 extracellular space cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-121214-150 Predicted to enable DNA binding activity. Predicted to be involved in chromatin silencing; defense response to other organism; and membrane disruption in other organism. Predicted to be located in extracellular space. Predicted to be part of nucleosome. Orthologous to human H2AC21 (H2A clustered histone 21).

Ensembl:

ensembl_id ENSDART00000073402

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00048116 lncRNA upstream 33894 36300651 ~ 36303026 (+) True XLOC_024303
TCONS_00049287 lncRNA upstream 63333 36269642 ~ 36273587 (+) True XLOC_024301
TCONS_00048111 lncRNA upstream 236211 36096364 ~ 36100709 (+) True XLOC_024299
TCONS_00049285 lncRNA upstream 321484 35988910 ~ 36015436 (+) True XLOC_024296
TCONS_00049288 lncRNA downstream 38830 36376136 ~ 36383338 (+) True XLOC_024323
TCONS_00049289 lncRNA downstream 61206 36398512 ~ 36404040 (+) True XLOC_024324
TCONS_00048138 lncRNA downstream 81471 36418777 ~ 36421945 (+) True XLOC_024325
TCONS_00049290 lncRNA downstream 111278 36448584 ~ 36451721 (+) False XLOC_024326
TCONS_00049291 lncRNA downstream 111648 36448954 ~ 36451721 (+) False XLOC_024326
TCONS_00048126 mRNA upstream 2553 36333993 ~ 36334367 (+) True XLOC_024313
TCONS_00048125 mRNA upstream 3827 36332782 ~ 36333093 (+) True XLOC_024312
TCONS_00048124 mRNA upstream 6887 36329623 ~ 36330033 (+) True XLOC_024311
TCONS_00048123 mRNA upstream 7915 36328524 ~ 36329005 (+) True XLOC_024310
TCONS_00048122 mRNA upstream 9016 36327034 ~ 36327904 (+) True XLOC_024309
TCONS_00048128 mRNA downstream 983 36338289 ~ 36338600 (+) True XLOC_024315
TCONS_00048129 mRNA downstream 2561 36339867 ~ 36340516 (+) True XLOC_024316
TCONS_00048130 mRNA downstream 4050 36341356 ~ 36341742 (+) True XLOC_024317
TCONS_00048131 mRNA downstream 5569 36342875 ~ 36343285 (+) True XLOC_024318
TCONS_00048132 mRNA downstream 8561 36345867 ~ 36346178 (+) True XLOC_024319
TCONS_00048100 other upstream 455389 35881415 ~ 35881531 (+) True XLOC_024292
TCONS_00048053 other upstream 1545454 34791362 ~ 34791466 (+) True XLOC_024254
TCONS_00048052 other upstream 1547301 34775558 ~ 34789619 (+) True XLOC_024253
TCONS_00048029 other upstream 2556292 33780513 ~ 33780628 (+) True XLOC_024239
TCONS_00048028 other upstream 2607522 33729284 ~ 33729398 (+) True XLOC_024238
TCONS_00048139 other downstream 119494 36456800 ~ 36456918 (+) True XLOC_024327
TCONS_00048140 other downstream 172368 36509674 ~ 36509789 (+) True XLOC_024328
TCONS_00048142 other downstream 506821 36844127 ~ 36844249 (+) True XLOC_024331
TCONS_00048157 other downstream 1029392 37366698 ~ 37366955 (+) False XLOC_024341
TCONS_00048162 other downstream 1098055 37435361 ~ 37439792 (+) False XLOC_024342

Expression Profile

//