RNA id: TCONS_00048124


Basic Information

Item Value
RNA id TCONS_00048124
length 411
RNA type mRNA
GC content 0.59
exon number 1
gene id XLOC_024311
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36329623 ~ 36330033 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCAAGAACCAAGCAGACCGCTCGTAAATCCACTGGAGGCAAAGCTCCAAGGAAGCAGCTCGCCACTAAAGCTGCTCGTAAGAGCGCTCCCGCCACTGGTGGCGTCAAGAAGCCTCACCGTTACAGGCCCGGTACCGTGGCTCTGCGTGAGATCCGTCGCTACCAGAAGTCCACTGAGCTGCTGATCCGCAAACTGCCCTTCCAGCGTCTGGTCCGTGAAATCGCTCAGGACTTCAAGACTGATCTGCGCTTCCAGAGCTCCGCCGTCATGGCTCTTCAGGAGTCCAGCGAAGCTTATCTGGTCGGTCTGTTCGAGGACACTAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGCGGAGAGCGTGCTTAG

Function

GO:

id name namespace
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-080220-24 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome. Predicted to be part of nucleosome. Predicted to be active in nucleus.

Ensembl:

ensembl_id ENSDART00000073405

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00048116 lncRNA upstream 26597 36300651 ~ 36303026 (+) True XLOC_024303
TCONS_00049287 lncRNA upstream 56036 36269642 ~ 36273587 (+) True XLOC_024301
TCONS_00048111 lncRNA upstream 228914 36096364 ~ 36100709 (+) True XLOC_024299
TCONS_00049285 lncRNA upstream 314187 35988910 ~ 36015436 (+) True XLOC_024296
TCONS_00049288 lncRNA downstream 46103 36376136 ~ 36383338 (+) True XLOC_024323
TCONS_00049289 lncRNA downstream 68479 36398512 ~ 36404040 (+) True XLOC_024324
TCONS_00048138 lncRNA downstream 88744 36418777 ~ 36421945 (+) True XLOC_024325
TCONS_00049290 lncRNA downstream 118551 36448584 ~ 36451721 (+) False XLOC_024326
TCONS_00049291 lncRNA downstream 118921 36448954 ~ 36451721 (+) False XLOC_024326
TCONS_00048123 mRNA upstream 618 36328524 ~ 36329005 (+) True XLOC_024310
TCONS_00048122 mRNA upstream 1719 36327034 ~ 36327904 (+) True XLOC_024309
TCONS_00048121 mRNA upstream 3519 36325793 ~ 36326104 (+) True XLOC_024308
TCONS_00048120 mRNA upstream 6848 36316280 ~ 36322775 (+) True XLOC_024307
TCONS_00048119 mRNA upstream 14185 36315127 ~ 36315438 (+) True XLOC_024306
TCONS_00048125 mRNA downstream 2749 36332782 ~ 36333093 (+) True XLOC_024312
TCONS_00048126 mRNA downstream 3960 36333993 ~ 36334367 (+) True XLOC_024313
TCONS_00048127 mRNA downstream 6887 36336920 ~ 36337306 (+) True XLOC_024314
TCONS_00048128 mRNA downstream 8256 36338289 ~ 36338600 (+) True XLOC_024315
TCONS_00048129 mRNA downstream 9834 36339867 ~ 36340516 (+) True XLOC_024316
TCONS_00048100 other upstream 448092 35881415 ~ 35881531 (+) True XLOC_024292
TCONS_00048053 other upstream 1538157 34791362 ~ 34791466 (+) True XLOC_024254
TCONS_00048052 other upstream 1540004 34775558 ~ 34789619 (+) True XLOC_024253
TCONS_00048029 other upstream 2548995 33780513 ~ 33780628 (+) True XLOC_024239
TCONS_00048028 other upstream 2600225 33729284 ~ 33729398 (+) True XLOC_024238
TCONS_00048139 other downstream 126767 36456800 ~ 36456918 (+) True XLOC_024327
TCONS_00048140 other downstream 179641 36509674 ~ 36509789 (+) True XLOC_024328
TCONS_00048142 other downstream 514094 36844127 ~ 36844249 (+) True XLOC_024331
TCONS_00048157 other downstream 1036665 37366698 ~ 37366955 (+) False XLOC_024341
TCONS_00048162 other downstream 1105328 37435361 ~ 37439792 (+) False XLOC_024342

Expression Profile

//