RNA id: TCONS_00048119


Basic Information

Item Value
RNA id TCONS_00048119
length 312
RNA type mRNA
GC content 0.54
exon number 1
gene id XLOC_024306
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36315127 ~ 36315438 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTCTGGAAGAGGTAAAGGTGGTAAAGGACTTGGGAAAGGAGGTGCTAAGCGTCACCGTAAAGTTCTCCGTGATAACATCCAGGGAATCACCAAACCCGCCATCCGTCGTCTCGCTCGCCGTGGCGGTGTGAAGCGTATCTCCGGTCTGATATACGAGGAGACCCGTGGTGTTCTTAAGGTGTTTCTGGAGAATGTTATCCGCGATGCTGTTACTTACACCGAGCACGCCAAGAGAAAGACCGTGACCGCCATGGATGTTGTGTACGCGCTGAAGAGACAGGGACGCACTCTGTACGGCTTCGGCGGTTAA

Function

GO:

id name namespace
GO:0006352 DNA-templated transcription, initiation biological_process
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070927-10 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to act upstream of or within DNA-templated transcription, initiation. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is expressed in head.

Ensembl:

ensembl_id ENSDART00000191984

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00048116 lncRNA upstream 12101 36300651 ~ 36303026 (+) True XLOC_024303
TCONS_00049287 lncRNA upstream 41540 36269642 ~ 36273587 (+) True XLOC_024301
TCONS_00048111 lncRNA upstream 214418 36096364 ~ 36100709 (+) True XLOC_024299
TCONS_00049285 lncRNA upstream 299691 35988910 ~ 36015436 (+) True XLOC_024296
TCONS_00049288 lncRNA downstream 60698 36376136 ~ 36383338 (+) True XLOC_024323
TCONS_00049289 lncRNA downstream 83074 36398512 ~ 36404040 (+) True XLOC_024324
TCONS_00048138 lncRNA downstream 103339 36418777 ~ 36421945 (+) True XLOC_024325
TCONS_00049290 lncRNA downstream 133146 36448584 ~ 36451721 (+) False XLOC_024326
TCONS_00049291 lncRNA downstream 133516 36448954 ~ 36451721 (+) False XLOC_024326
TCONS_00048118 mRNA upstream 2258 36312459 ~ 36312869 (+) True XLOC_024305
TCONS_00048117 mRNA upstream 3408 36311333 ~ 36311719 (+) True XLOC_024304
TCONS_00048114 mRNA upstream 5112 36292057 ~ 36310015 (+) False XLOC_024303
TCONS_00048113 mRNA upstream 11412 36279157 ~ 36303715 (+) True XLOC_024302
TCONS_00048115 mRNA upstream 12078 36292465 ~ 36303049 (+) False XLOC_024303
TCONS_00048120 mRNA downstream 842 36316280 ~ 36322775 (+) True XLOC_024307
TCONS_00048121 mRNA downstream 10355 36325793 ~ 36326104 (+) True XLOC_024308
TCONS_00048122 mRNA downstream 11596 36327034 ~ 36327904 (+) True XLOC_024309
TCONS_00048123 mRNA downstream 13086 36328524 ~ 36329005 (+) True XLOC_024310
TCONS_00048124 mRNA downstream 14185 36329623 ~ 36330033 (+) True XLOC_024311
TCONS_00048100 other upstream 433596 35881415 ~ 35881531 (+) True XLOC_024292
TCONS_00048053 other upstream 1523661 34791362 ~ 34791466 (+) True XLOC_024254
TCONS_00048052 other upstream 1525508 34775558 ~ 34789619 (+) True XLOC_024253
TCONS_00048029 other upstream 2534499 33780513 ~ 33780628 (+) True XLOC_024239
TCONS_00048028 other upstream 2585729 33729284 ~ 33729398 (+) True XLOC_024238
TCONS_00048139 other downstream 141362 36456800 ~ 36456918 (+) True XLOC_024327
TCONS_00048140 other downstream 194236 36509674 ~ 36509789 (+) True XLOC_024328
TCONS_00048142 other downstream 528689 36844127 ~ 36844249 (+) True XLOC_024331
TCONS_00048157 other downstream 1051260 37366698 ~ 37366955 (+) False XLOC_024341
TCONS_00048162 other downstream 1119923 37435361 ~ 37439792 (+) False XLOC_024342

Expression Profile

//