RNA id: TCONS_00048135


Basic Information

Item Value
RNA id TCONS_00048135
length 411
RNA type mRNA
GC content 0.60
exon number 1
gene id XLOC_024322
representative True

Chromosome Information

Item Value
chromosome id NC_007136.7
NCBI id CM002909.2
chromosome length 37502051
location 36349574 ~ 36349984 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCAAGAACCAAGCAGACCGCCCGTAAATCTACCGGAGGCAAAGCCCCGAGGAAGCAACTCGCCACTAAAGCCGCTCGTAAAAGCGCTCCGGCTACCGGCGGCGTCAAGAAGCCTCACCGTTACAGGCCCGGTACCGTGGCTCTGAGAGAGATCCGTCGCTACCAGAAATCCACTGAGCTGTTGATCCGCAAACTGCCCTTCCAGCGTCTGGTCCGAGAAATCGCTCAGGACTTCAAGACAGATCTGCGCTTCCAGAGCTCCGCCGTCATGGCTCTTCAGGAGTCCAGCGAGGCTTATCTGGTCGGTCTGTTCGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGCGGAGAGCGCGCTTAA

Function

GO:

id name namespace
GO:0000786 nucleosome cellular_component
GO:0005634 nucleus cellular_component
GO:0005694 chromosome cellular_component
GO:0003677 DNA binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-080220-24 Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be located in chromosome. Predicted to be part of nucleosome. Predicted to be active in nucleus.

Ensembl:

ensembl_id ENSDART00000184101

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00048116 lncRNA upstream 46548 36300651 ~ 36303026 (+) True XLOC_024303
TCONS_00049287 lncRNA upstream 75987 36269642 ~ 36273587 (+) True XLOC_024301
TCONS_00048111 lncRNA upstream 248865 36096364 ~ 36100709 (+) True XLOC_024299
TCONS_00049285 lncRNA upstream 334138 35988910 ~ 36015436 (+) True XLOC_024296
TCONS_00049288 lncRNA downstream 26152 36376136 ~ 36383338 (+) True XLOC_024323
TCONS_00049289 lncRNA downstream 48528 36398512 ~ 36404040 (+) True XLOC_024324
TCONS_00048138 lncRNA downstream 68793 36418777 ~ 36421945 (+) True XLOC_024325
TCONS_00049290 lncRNA downstream 98600 36448584 ~ 36451721 (+) False XLOC_024326
TCONS_00049291 lncRNA downstream 98970 36448954 ~ 36451721 (+) False XLOC_024326
TCONS_00048134 mRNA upstream 562 36348401 ~ 36349012 (+) True XLOC_024321
TCONS_00048133 mRNA upstream 2074 36347126 ~ 36347500 (+) True XLOC_024320
TCONS_00048132 mRNA upstream 3396 36345867 ~ 36346178 (+) True XLOC_024319
TCONS_00048131 mRNA upstream 6289 36342875 ~ 36343285 (+) True XLOC_024318
TCONS_00048130 mRNA upstream 7832 36341356 ~ 36341742 (+) True XLOC_024317
TCONS_00048136 mRNA downstream 55037 36405021 ~ 36428603 (+) False XLOC_024325
TCONS_00048137 mRNA downstream 61640 36411624 ~ 36437925 (+) False XLOC_024325
TCONS_00048141 mRNA downstream 324731 36674715 ~ 36676981 (+) True XLOC_024329
TCONS_00048143 mRNA downstream 776937 37126921 ~ 37137446 (+) False XLOC_024332
TCONS_00048144 mRNA downstream 780466 37130450 ~ 37134912 (+) True XLOC_024332
TCONS_00048100 other upstream 468043 35881415 ~ 35881531 (+) True XLOC_024292
TCONS_00048053 other upstream 1558108 34791362 ~ 34791466 (+) True XLOC_024254
TCONS_00048052 other upstream 1559955 34775558 ~ 34789619 (+) True XLOC_024253
TCONS_00048029 other upstream 2568946 33780513 ~ 33780628 (+) True XLOC_024239
TCONS_00048028 other upstream 2620176 33729284 ~ 33729398 (+) True XLOC_024238
TCONS_00048139 other downstream 106816 36456800 ~ 36456918 (+) True XLOC_024327
TCONS_00048140 other downstream 159690 36509674 ~ 36509789 (+) True XLOC_024328
TCONS_00048142 other downstream 494143 36844127 ~ 36844249 (+) True XLOC_024331
TCONS_00048157 other downstream 1016714 37366698 ~ 37366955 (+) False XLOC_024341
TCONS_00048162 other downstream 1085377 37435361 ~ 37439792 (+) False XLOC_024342

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
eurasian perch (Perca fluviatilis) TU143816 False 2881 lncRNA 0.44 2 NC_053121.1 22331012 ~ 22378340 (+)
bowfin (Amia calva) TU143816 False 2688 TUCP 0.45 3 CM030135.1 4060811 ~ 4064248 (-)
tiger barb (Puntius tetrazona) TU143816 False 470 lncRNA 0.38 2 NC_056712.1 4389286 ~ 4474506 (-)