hba1 (hba1)


Basic Information

Item Value
gene id hba1
gene name hba1
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 73585417 ~ 73586189 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>NM_001124551.2
AATGAGTCTGACAGCAAAGGACAAATCTGTGGTCAAGGCCTTCTGGGGCAAGATTAGTGGAAAGGCAGATGTCGTCGGTGCTGAGGCTTTGGGGAGGATGCTGACTGCTTACCCCCAGACTAAGACCTACTTCTCCCACTGGGCAGACCTGAGCCCCGGCTCTGGGCCAGTCAAGAAGCATGGAGGCATCATCATGGGTGCAATTGGTAAAGCAGTCGGACTGATGGACGACCTCGTGGGGGGAATGAGTGCTCTCAGCGATCTGCACGCCTTCAACCTGCGCGTTGACCCTGGAAACTTCAAGATCCTGTCCCACAACATCCTTGTGACCCTGGCTATTCACTTCCCTTCTGATTTCACTCCCGAAGTGCACATTGCTGTGGATAAATTCCTTGCAGCCGTGTCCGCTGCCCTGGCTGACAAATACAGATAAGACCATCATGAAAGTCCATCATTTGATTCCAG

Function

symbol description
hba1 Contributes to haptoglobin binding activity and peroxidase activity. Involved in hydrogen peroxide catabolic process; positive regulation of cell death; and response to hydrogen peroxide. Located in extracellular space. Part of cytosolic small ribosomal subunit; haptoglobin-hemoglobin complex; and hemoglobin complex. Implicated in Heinz body anemia; alpha thalassemia; familial erythrocytosis 7; and hemoglobin H disease. Biomarker of alpha thalassemia.

NR:

description
hemoglobin subunit alpha

GO:

id name namespace
GO:0015671 oxygen transport biological_process
GO:0005833 hemoglobin complex cellular_component
GO:0005506 iron ion binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0020037 heme binding molecular_function

KEGG:

id description
K13826 HBZ; hemoglobin subunit zeta

RNA

RNA id representative length rna type GC content exon number start site end site
NM_001124551.2 True 465 mRNA 0.53 3 73585417 73586189

Neighbor

gene id symbol gene type direction distance location
LOC110538450 LOC106601071 coding upstream 15614 73568810 ~ 73569803 (+)
LOC110538451 LOC106601078 coding upstream 22013 73562501 ~ 73563404 (+)
LOC110538454 NA coding upstream 25873 73553308 ~ 73559544 (+)
mpg LOC106601084 coding upstream 45529 73533277 ~ 73539888 (+)
LOC110538456 LOC106601142 coding upstream 122526 73459899 ~ 73462891 (+)
LOC110538448 hba1 coding downstream 10396 73596585 ~ 73597588 (+)
hba4 hba4 coding downstream 14871 73601060 ~ 73601971 (+)
LOC110538449 hba1 coding downstream 22465 73608654 ~ 73613476 (+)
LOC110538447 LOC106601071 coding downstream 33055 73619244 ~ 73620456 (+)
LOC110538437 LOC106601064 coding downstream 42464 73628653 ~ 73629929 (+)
G1109608 LOC106607371 non-coding upstream 24105 73560328 ~ 73561312 (+)
G1109637 NA non-coding upstream 29444 73555743 ~ 73555973 (+)
G1109636 NA non-coding upstream 30375 73554773 ~ 73555042 (+)
G1109591 NA non-coding upstream 80247 73504614 ~ 73505170 (+)
G1109572 LOC106607368 non-coding upstream 113629 73468972 ~ 73471788 (+)
G1109605 NA non-coding downstream 12622 73598811 ~ 73684593 (+)
G1109647 LOC106589010 non-coding downstream 19430 73605619 ~ 73606983 (+)
G1109618 NA non-coding downstream 23378 73609567 ~ 73610146 (+)
G1109665 LOC100135790 non-coding downstream 52969 73639158 ~ 73645348 (+)
G1109688 LOC100135791 non-coding downstream 98674 73684863 ~ 73692904 (+)
LOC110538462 rpc11 other upstream 199550 73384755 ~ 73386199 (+)
G1109505 NA other upstream 279263 73305425 ~ 73306154 (+)
LOC110538241 LOC106607115 other upstream 1567127 72016045 ~ 72019145 (+)
psmg3 psmg3 other upstream 1642618 71941515 ~ 71942804 (+)
G1105655 NA other upstream 2678988 70902905 ~ 70906429 (+)
G1109778 NA other downstream 247454 73833643 ~ 73834606 (+)
G1109786 NA other downstream 260066 73846255 ~ 73846794 (+)
G1111126 LOC106578813 other downstream 1374077 74960266 ~ 75048356 (+)
G1111805 LOC105030512 other downstream 1832600 75418789 ~ 75423163 (+)
G1111961 NA other downstream 2158950 75745139 ~ 75745620 (+)

Expression


Co-expression Network