XLOC_030781 (cst14b.1)


Basic Information

Item Value
gene id XLOC_030781
gene name cst14b.1
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 4523633 ~ 4532516 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00059916
ATGGCAACTAAAAAAGTTGGAGGTCAATCGGAGGAAAAACAGGCCACTCCTGAGGTGCAGAAGATCTGCGATGAGGTCAAGCATCAAGCAGAAGAAAAGGCTGGAAAGAAGTTCACTGCTTTCACTGCCATTCTGTTCACCACACAGGTCGTGGCCGGGACCAACTATTTCATCAAGGTCAATGTGGGAGGAGATCAGTTTATTCATCTGAGAGTTCACAAACCGCTTCCTCACGCTGGAGATAAAGTACAGCTGCAAGGCATTCAGGTGTCGAAAAGTTGTCAAGACCCCATCCATTACTTCTAA

Function

symbol description
cst14b.1 Predicted to enable cysteine-type endopeptidase inhibitor activity. Predicted to be active in cytosol. Human ortholog(s) of this gene implicated in Unverricht-Lundborg syndrome and progressive myoclonus epilepsy 1A. Orthologous to human CSTB (cystatin B).

GO:

id name namespace
GO:0005829 cytosol cellular_component
GO:0004866 endopeptidase inhibitor activity molecular_function
GO:0004869 cysteine-type endopeptidase inhibitor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-061013-189 Predicted to enable cysteine-type endopeptidase inhibitor activity. Predicted to be active in cytosol. Human ortholog(s) of this gene implicated in Unverricht-Lundborg syndrome and progressive myoclonus epilepsy 1A. Orthologous to human CSTB (cystatin B).

Ensembl:

ensembl_id ENSDARG00000117133

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00059916 True 306 mRNA 0.47 3 4523633 4532516

Neighbor

gene id symbol gene type direction distance location
XLOC_030780 zgc:153704 coding downstream 30131 4482437 ~ 4493502 (-)
XLOC_030779 apooa coding downstream 105078 4382378 ~ 4418555 (-)
XLOC_030778 srrt coding downstream 226174 4253929 ~ 4297459 (-)
XLOC_030777 si:ch211-283g2.3 coding downstream 278447 4232196 ~ 4245186 (-)
XLOC_030776 si:ch211-283g2.2 coding downstream 293263 4223515 ~ 4230370 (-)
XLOC_030782 NA coding upstream 88914 4621430 ~ 4622063 (-)
XLOC_030783 FO834903.1 coding upstream 107943 4640459 ~ 4643289 (-)
XLOC_030784 NA coding upstream 137755 4670271 ~ 4673865 (-)
XLOC_030785 CU915770.1 coding upstream 153159 4685675 ~ 4697367 (-)
XLOC_030786 CU915770.2 coding upstream 182216 4714732 ~ 4734142 (-)
XLOC_030772 CU655870.1 non-coding downstream 587037 3935917 ~ 3936596 (-)
XLOC_030767 FO704648.2 non-coding downstream 853395 3660658 ~ 3670238 (-)
XLOC_030764 NA non-coding downstream 968824 3553600 ~ 3554809 (-)
XLOC_030763 NA non-coding downstream 1021798 3473865 ~ 3501835 (-)
XLOC_030762 NA non-coding downstream 1169066 3352108 ~ 3354567 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location