G2574



Basic Information


Item Value
gene id G2574
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053112.1
NCBI id CM020909.1
chromosome length 48724115
location 8055499 ~ 8078861 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU3591
caaccaggcagagcaacgaagaaggtagcagagctagttgatagattaaacttttgccgtatccggtcggcaaaacccccgaacacatcttccttttttaagaatgatttcagtgccgttctttgttcttttctcaaagaaaagctgaactccaagtcttcagaagaccgctgttcccagcagcagccataagccccgcccaccgact

Function


GO:

id name namespace
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU3591 True 208 lncRNA 0.56 2 8055499 8078861

Neighbor


gene id symbol gene type direction distance location
acta1a actc1a,act2,zgc:86709,LOC105024319,LOC102689871,LOC100534413 coding upstream 6112 8038319 ~ 8049387 (+)
nup133 nup133 coding upstream 23635 7979869 ~ 8031864 (+)
ifngr1 NA coding upstream 142349 7900622 ~ 7913150 (+)
LOC120565283 NA coding upstream 167125 7876002 ~ 7888374 (+)
LOC120562006 NA coding upstream 181899 7866252 ~ 7873600 (+)
LOC120558905 NA coding downstream 30482 8109343 ~ 8115194 (+)
LOC120558930 NA coding downstream 132210 8211071 ~ 8215041 (+)
LOC120558872 NA coding downstream 293996 8372857 ~ 8380700 (+)
mrpl45 mrpl45 coding downstream 484187 8563048 ~ 8575327 (+)
sp2 sp2 coding downstream 569198 8648059 ~ 8669290 (+)
G2572 NA non-coding upstream 6976 8048236 ~ 8048523 (+)
G2569 NA non-coding upstream 37591 8017443 ~ 8017908 (+)
G2566 NA non-coding upstream 77207 7977959 ~ 7978292 (+)
G2565 NA non-coding upstream 79002 7976161 ~ 7976497 (+)
G2564 NA non-coding upstream 79618 7975669 ~ 7975881 (+)
G2582 NA non-coding downstream 364 8079225 ~ 8081486 (+)
G2595 NA non-coding downstream 20166 8099027 ~ 8325259 (+)
G2598 NA non-coding downstream 33554 8112415 ~ 8270545 (+)
G2606 NA non-coding downstream 48506 8127367 ~ 8128039 (+)
G2609 NA non-coding downstream 53191 8132052 ~ 8134352 (+)
G2557 NA other upstream 107246 7941547 ~ 7948253 (+)
G2530 NA other upstream 355959 7699265 ~ 7699540 (+)
G1973 NA other upstream 1521129 6532441 ~ 6534370 (+)
aftpha LOC102296338,LOC102796226,LOC101483123,LOC102200161 other upstream 1618282 6407400 ~ 6437217 (+)
LOC120573424 lgalsl,LOC104947409 other upstream 1652859 6385601 ~ 6402640 (+)
G2590 NA other downstream 10952 8089813 ~ 8091505 (+)
LOC120565323 NA other downstream 322854 8401715 ~ 8415076 (+)
socs7 socs7 other downstream 538522 8617383 ~ 8643702 (+)
abcc10 abcc10,LOC107102248 other downstream 591310 8670171 ~ 8702455 (+)
zbtb45 zbtb45,LOC102796714,LOC102207372,LOC100704009,LOC104952775,LOC103470204,LOC101487628 other downstream 812454 8891315 ~ 8911908 (+)

Expression



Co-expression Network