G84880 (ino80d,LOC106582458)


Basic Information

Item Value
gene id G84880
gene name ino80d,LOC106582458
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047599.1
NCBI id CM018545.1
chromosome length 32114633
location 18133402 ~ 18133689 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU100814
ACTCACCTGCGGTCCTCAGCTTTAGGAATGGGATTTGTGCATCGCTGGCTGTTGTACTTGGCCACATATTCACACTGTTTAAAGGGAGCAGTCTTGTCCTCTAAAACGTGCCGTATGCAGAAGGCGTATCCATTGAGTCTGCGCTGCTTGCAGAGTTTAGGGCTGTATGAGCACAAAGGCTTATTGTCCACCTCCGAGAAGTGTATGTGTTTCCCCTCATACATCACGTGACTCTATTCCTTGAAAACATCAGCTGACAAGAAAAAGTCAAAAAGACTAAGTATAACT

Function

symbol description
ino80d Predicted to be involved in DNA recombination and DNA repair. Predicted to be located in nucleoplasm. Predicted to be active in nucleus.

NR:

description
PREDICTED: INO80 complex subunit D isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU100814 True 288 lncRNA 0.45 1 18133402 18133689

Neighbor

gene id symbol gene type direction distance location
LOC113525937 adam23,LOC108267022,LOC108424345 coding downstream 18997 18088623 ~ 18114405 (-)
LOC113526302 LOC108266276 coding downstream 48531 18082115 ~ 18084871 (-)
casp10 NA coding downstream 57080 18068228 ~ 18076322 (-)
prkra prkra coding downstream 71133 18054788 ~ 18062269 (-)
pde11a pde11a,LOC107671328,LOC107657382 coding downstream 141891 17937053 ~ 17991511 (-)
stk24a stk24 coding upstream 12717 18146406 ~ 18161642 (-)
slc15a1a slc15a1,LOC108239716,LOC101165016 coding upstream 29491 18163180 ~ 18174048 (-)
zmp:0000001200 dock9 coding upstream 41307 18174996 ~ 18258225 (-)
LOC113526154 farp1 coding upstream 127546 18261235 ~ 18313731 (-)
LOC113526158 rap2a,LOC103043765,LOC100332969,LOC106582448,LOC103391592,LOC105907999,LOC101166017,LOC107549783 coding upstream 191718 18325407 ~ 18337210 (-)
G84881 NA non-coding downstream 1404 18131410 ~ 18131998 (-)
G84411 NA non-coding downstream 299813 17833375 ~ 17833589 (-)
LOC117597384 NA non-coding downstream 389377 17740637 ~ 17744025 (-)
G84394 NA non-coding downstream 405405 17726653 ~ 17727997 (-)
LOC117597450 NA non-coding downstream 701971 17407218 ~ 17431431 (-)
G84882 LOC108266575 non-coding upstream 1147 18134836 ~ 18135614 (-)
G84883 LOC108266575,LOC108424342 non-coding upstream 1980 18135669 ~ 18137083 (-)
G84975 xirp2 non-coding upstream 406664 18540353 ~ 18555865 (-)
G85069 NA non-coding upstream 534302 18667991 ~ 18668211 (-)
G85205 NA non-coding upstream 904538 19038227 ~ 19038432 (-)
evx2 evx2,LOC107657379,LOC107671304 other downstream 433422 17695290 ~ 17699980 (-)
sp3a sp3 other downstream 752230 17371979 ~ 17381172 (-)
mettl8 mettl8 other downstream 1093559 17028237 ~ 17039843 (-)
si:dkey-91i10.2 LOC108266132,LOC106530433,LOC107658202 other downstream 1726924 16370227 ~ 16406478 (-)
G83554 NA other downstream 1912536 16219964 ~ 16220866 (-)
LOC113526313 baz2b other upstream 779698 18913387 ~ 18968492 (-)
grb14 grb14 other upstream 1309402 19443091 ~ 19494515 (-)
steap3 steap3,dbi,LOC107560815,LOC107747240 other upstream 1435060 19568749 ~ 19586103 (-)
G85848 NA other upstream 2093039 20226728 ~ 20237615 (-)
abcb6b LOC108266852,LOC108423985,LOC107596549,LOC107750068 other upstream 2260782 20394471 ~ 20423244 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G1813588 ino80d unknown NC_048586.1 CM023240.2 44362661 ~ 44371923 (+)