G122061 (tardbp,LOC107716231,LOC107586522)


Basic Information

Item Value
gene id G122061
gene name tardbp,LOC107716231,LOC107586522
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030136.1
NCBI id CM030136.1
chromosome length 27394605
location 9621028 ~ 9621472 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU153025
ACCTGGTCATCTGCGAAAGTGACGAACGCAAAAGCCCGAAAAGGCTTGGGGATGAAGACATCTGTGACCTCTCCGTACTGCATGAAGAACTGTCGGAGCTCTTCAGCAGTCATGTCTTCAGTGCAGCGACCTACAAACACTTTTCTGCTCCTCAGGGGCTCATCAGGGCTTTGCTGTTCCCCCCCCTTCGAGTTAGGTAGCTTGCAGTCACACCATCTGCCATCGATCATGTGCCGCTGGGACATCACTTTCACTTGCGTTTCATATTCTGTGAATCTCACAAAGCCAAAGCCCTTGGAGTTGCCCGTTTTAACATCTCGTTTAAC

Function

symbol description
tardbp Enables double-stranded DNA binding activity; identical protein binding activity; and mRNA 3'-UTR binding activity. Involved in several processes, including negative regulation by host of viral transcription; nuclear inner membrane organization; and regulation of mRNA stability. Located in nucleoplasm. Implicated in Parkinson's disease; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis type 10; and motor neuron disease. Biomarker of Lewy body dementia; neurodegenerative disease (multiple); and progressive supranuclear palsy.

NR:

description
TAR DNA-binding protein 43 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU153025 True 326 lncRNA 0.51 2 9621028 9621472

Neighbor

gene id symbol gene type direction distance location
AMCG00002263 NA coding downstream 264058 9309416 ~ 9356970 (-)
AMCG00002259 NA coding downstream 412329 9200586 ~ 9208699 (-)
AMCG00002260 NA coding downstream 427599 9193199 ~ 9193429 (-)
AMCG00002250 NA coding downstream 559933 9055314 ~ 9061095 (-)
AMCG00002248 ubiad1 coding downstream 598757 9018607 ~ 9022271 (-)
AMCG00002271 NA coding upstream 7178 9628650 ~ 9629679 (-)
AMCG00002267 NA coding upstream 8658 9630130 ~ 9637266 (-)
AMCG00002270 pgd,LOC107716232,LOC107681986 coding upstream 21774 9643246 ~ 9650610 (-)
AMCG00002269 kif1b coding upstream 40036 9661508 ~ 9692975 (-)
AMCG00002268 NA coding upstream 72288 9693760 ~ 9725266 (-)
G122037 NA non-coding downstream 333441 9283969 ~ 9287587 (-)
G122019 NA non-coding downstream 407599 9138447 ~ 9213429 (-)
G121935 NA non-coding downstream 602701 9018126 ~ 9018327 (-)
G121912 NA non-coding downstream 687865 8932163 ~ 8933163 (-)
G121885 NA non-coding downstream 750330 8868645 ~ 8870698 (-)
G122131 NA non-coding upstream 226763 9848235 ~ 9851376 (-)
G122226 NA non-coding upstream 601741 10223213 ~ 10224982 (-)
G122302 NA non-coding upstream 1128939 10750411 ~ 10750781 (-)
G122319 NA non-coding upstream 1190714 10812186 ~ 10813876 (-)
G122376 NA non-coding upstream 1646092 11267564 ~ 11274527 (-)
AMCG00002265 NA other downstream 901 9608750 ~ 9620127 (-)
AMCG00002223 NA other downstream 1781617 7826641 ~ 7839411 (-)
AMCG00002167 NA other downstream 3605635 5975725 ~ 6015393 (-)
G120993 NA other downstream 5401151 4214715 ~ 4219877 (-)
G120927 slc45a1,LOC107756616,LOC106565711,LOC107702000 other downstream 5834484 3784236 ~ 3786544 (-)
AMCG00002275 ube4b,LOC107681967,LOC107570768 other upstream 135953 9757425 ~ 9801108 (-)
AMCG00002276 NA other upstream 209047 9830519 ~ 9833224 (-)
AMCG00002279 NA other upstream 215446 9836918 ~ 9853075 (-)
AMCG00002288 NA other upstream 648417 10269889 ~ 10279984 (-)
AMCG00002301 NA other upstream 1216332 10837804 ~ 10847201 (-)

Expression


Co-expression Network