AMCG00003575 (nkx2.2a,LOC103359019,LOC101157822,LOC101466937,LOC107392558)


Basic Information

Item Value
gene id AMCG00003575
gene name nkx2.2a,LOC103359019,LOC101157822,LOC101466937,LOC107392558
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 10179342 ~ 10181960 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003575
ATGTCGTTGACCAACACAAAGACGGGCTTTTCTGTAAAGGACATCTTGGACCTCCCTGATACGAATGATGAAGAAGGATCTATGATAATCCTTACACAAGATGGCTTGCCACTACGGACAGCATTCAATACTCATAACCACAGGTACAAGATGAAGCGAGCCCGGGCCGAGAAAGGTATGGAAGTGACCCATCTCCCCTCCCCTCGGCGGGTGGCAGTGCCCGTCCTAGTCAGGGATGGCAAGCCGTGCCATACTCTTAAAGCTCAGGACTTGGCAGCCACTTTCCAGGCTGGGATCCCTTTCTCGGCATATAGCGCCCAGTCTCTCCAGCATATGCAATATAACGCCCAGTACAGTTCCGCCACCACTCCACAGTTCCCCACAGCGCACCATTTGGTGCAAACACAACAGTGGACTTGGTGA

Function

symbol description
nkx2.2a Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in positive regulation of transcription, DNA-templated. Acts upstream of or within endocrine pancreas development; floor plate formation; and neurogenesis. Predicted to be active in nucleus. Is expressed in several structures, including central nervous system; digestive system; neural keel; neural rod; and neural tube. Orthologous to human NKX2-2 (NK2 homeobox 2).

NR:

description
PREDICTED: homeobox protein Nkx-2.2a

GO:

id name namespace
GO:0021530 spinal cord oligodendrocyte cell fate specification biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0031018 endocrine pancreas development biological_process
GO:0014044 Schwann cell development biological_process
GO:0008045 motor neuron axon guidance biological_process
GO:0008347 glial cell migration biological_process
GO:0021508 floor plate formation biological_process
GO:0021514 ventral spinal cord interneuron differentiation biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K08029 NKX2-2; homeobox protein Nkx-2.2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003575 True 423 mRNA 0.52 3 10179342 10181960

Neighbor

gene id symbol gene type direction distance location
AMCG00003571 foxa2,LOC105909438 coding upstream 284354 9892778 ~ 9894988 (+)
AMCG00003568 LOC104960473 coding upstream 303499 9866100 ~ 9875843 (+)
AMCG00003569 prkd3,LOC101070414,LOC105015789 coding upstream 325670 9820927 ~ 9853672 (+)
AMCG00003562 NA coding upstream 405245 9760860 ~ 9774097 (+)
AMCG00003558 NA coding upstream 639261 9538315 ~ 9540081 (+)
AMCG00003576 nkx2.1a,LOC105015794,LOC106610802,LOC102798947,LOC108428605,LOC100709876,LOC101467433 coding downstream 48161 10230121 ~ 10231671 (+)
AMCG00003580 NA coding downstream 293877 10475837 ~ 10495920 (+)
AMCG00003581 ralgapa2 coding downstream 324598 10506558 ~ 10532085 (+)
AMCG00003583 crnkl1,LOC106607683,LOC106571265 coding downstream 435597 10617557 ~ 10623372 (+)
AMCG00003590 NA coding downstream 447613 10629573 ~ 10631480 (+)
G1574 NA non-coding upstream 475864 9700557 ~ 9703478 (+)
G1430 ywhaqb,ywhaq,LOC105896734,LOC108436740,LOC107733143,LOC107674035,LOC107752793 non-coding upstream 1151710 9009297 ~ 9027632 (+)
G1375 NA non-coding upstream 1335260 8843827 ~ 8844082 (+)
G1347 NA non-coding upstream 1478788 8699466 ~ 8700554 (+)
G1343 NA non-coding upstream 1512415 8661032 ~ 8666927 (+)
G1706 NA non-coding downstream 54896 10236856 ~ 10238261 (+)
G1747 ralgapa2 non-coding downstream 249704 10431664 ~ 10457765 (+)
G1855 NA non-coding downstream 868191 11050151 ~ 11050644 (+)
G1891 NA non-coding downstream 1045999 11227959 ~ 11228275 (+)
G1902 NA non-coding downstream 1149079 11331039 ~ 11403029 (+)
AMCG00003570 NA other upstream 397586 9777508 ~ 9781756 (+)
AMCG00003551 NA other upstream 915874 9255828 ~ 9263468 (+)
AMCG00003544 NA other upstream 1072577 9075890 ~ 9106765 (+)
AMCG00003541 asap2,LOC106566627 other upstream 1237591 8900456 ~ 8941751 (+)
AMCG00003534 id2,LOC106566577 other upstream 1526872 8649125 ~ 8652470 (+)
AMCG00003604 NA other downstream 1279703 11461663 ~ 11482931 (+)
AMCG00003606 NA other downstream 1308225 11490185 ~ 11491597 (+)
G1989 cnr1,LOC104936193 other downstream 1391771 11573731 ~ 11577329 (+)
AMCG00003614 NA other downstream 1543123 11725083 ~ 11729991 (+)
AMCG00003643 kif25,LOC100703631,LOC102203072 other downstream 2720606 12902566 ~ 12917002 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_012307 nkx2.2a coding NC_007128.7 CM002901.2 42208623 ~ 42218652 (-)
grasscarp (Ctenopharyngodon idella) CI01000314_00705124_00706620 NKX2-2, NKX2.2A, NX22A coding CI01000314 null 704768 ~ 706651 (-)