G136864 (psmb4)


Basic Information

Item Value
gene id G136864
gene name psmb4
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 18385289 ~ 18388306 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU172065
CCTCACGTGCGACCCGCGGACCGGGCACTTACACCATCTGCTCGATGATCTGTTTGAGGTACTGGTAGTCAGCGTAGTCCCCCGAGGCCCCCAGGATGGTGTTGTCGTTGACCTTCATGATGCGTGAGATGTTACGGAAGCGCGCCAGTGACCCGTACGAGCCCAGCATGTCCGCCGCGATGATGACGCCGCCGTCGAACTTCACGCCCAGCACCGACGTCCCCGTCACCATGGGGTTTTGTGTGTCTCACGGGTCCGCATGCCGGGCTCGTCGCGCCGCTCTGGCCGGGGAAGGAATAAAACTCGCCGGGTTTCGGTCCATTCTCCCAGAAATTGAGTTTGATTCCTCTGGCGTCCATTTTGAAAACTGGCGGAAGTGACGTCGGGTCGCTTCCGTAAGATGATTGGAGGGGGGACTAAACGCAACCGGCGGCCATTTTGGGTACTGGCGGGGAAGACACGGCATTG

Function

symbol description
psmb4 Predicted to enable threonine-type endopeptidase activity. Predicted to be involved in proteasomal protein catabolic process. Predicted to act upstream of or within proteolysis involved in cellular protein catabolic process. Predicted to be located in cytoplasm. Predicted to be part of proteasome core complex, beta-subunit complex. Predicted to be active in nucleus. Orthologous to human PSMB4 (proteasome 20S subunit beta 4).

NR:

description
PREDICTED: proteasome subunit beta type-4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU172065 True 468 TUCP 0.60 2 18385289 18388306

Neighbor

gene id symbol gene type direction distance location
AMCG00012446 NA coding upstream 9296 18353011 ~ 18375993 (+)
AMCG00012447 NA coding upstream 34388 18329924 ~ 18350901 (+)
AMCG00012440 anp32e,LOC100707939,LOC102193634,LOC102789185 coding upstream 148101 18229745 ~ 18237188 (+)
AMCG00012431 NA coding upstream 205472 18174010 ~ 18179817 (+)
AMCG00012432 NA coding upstream 215545 18162576 ~ 18169744 (+)
AMCG00012454 selenbp1,LOC107588475,LOC107556087 coding downstream 1525 18389831 ~ 18401677 (+)
AMCG00012451 LOC101076171,LOC102795628 coding downstream 13999 18402305 ~ 18414912 (+)
AMCG00012452 pi4kb,LOC107588477,LOC107556110 coding downstream 28657 18416963 ~ 18442351 (+)
AMCG00012453 NA coding downstream 56805 18445111 ~ 18466585 (+)
AMCG00012457 NA coding downstream 88405 18476711 ~ 18491471 (+)
G136848 NA non-coding upstream 68213 18295215 ~ 18317076 (+)
G136842 NA non-coding upstream 115782 18261897 ~ 18269507 (+)
G136718 NA non-coding upstream 483633 17900908 ~ 17901656 (+)
G136571 NA non-coding upstream 721119 17663433 ~ 17664170 (+)
G136568 NA non-coding upstream 736182 17648628 ~ 17649107 (+)
G136866 NA non-coding downstream 45264 18433570 ~ 18470784 (+)
G136873 NA non-coding downstream 84927 18473233 ~ 18474916 (+)
G136969 NA non-coding downstream 227592 18615898 ~ 18653598 (+)
G137007 NA non-coding downstream 514206 18902512 ~ 18902871 (+)
G137016 NA non-coding downstream 544118 18932424 ~ 18933248 (+)
AMCG00012439 NA other upstream 250908 18130284 ~ 18134381 (+)
G136720 cct3,tcpg,LOC107597996,LOC107587818,LOC107741740,LOC107671634,LOC107704884 other upstream 481479 17902832 ~ 17903810 (+)
G136658 NA other upstream 541368 17840933 ~ 17843921 (+)
AMCG00012423 LOC102799202,LOC107564869 other upstream 590045 17792251 ~ 17795244 (+)
G136641 NA other upstream 617758 17764145 ~ 17767531 (+)
AMCG00012460 NA other downstream 151239 18539545 ~ 18544490 (+)
AMCG00012471 NA other downstream 659191 19047497 ~ 19053829 (+)
G137083 NA other downstream 781442 19169748 ~ 19174421 (+)
G137111 ctsk,LOC107689854,LOC107587836,LOC107741754,LOC108441922 other downstream 849383 19237689 ~ 19238958 (+)
AMCG00012480 NA other downstream 944022 19332328 ~ 19350202 (+)

Expression


Co-expression Network