G137111 (ctsk,LOC107689854,LOC107587836,LOC107741754,LOC108441922)


Basic Information

Item Value
gene id G137111
gene name ctsk,LOC107689854,LOC107587836,LOC107741754,LOC108441922
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 19237689 ~ 19238958 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU172360
CACAGAATTTGATGGTTGGCGTTCATGGAAGTACCCACCTGTCCCACGTACGGGTAGGACTCCTCAGAGTCAATGCCGCGGTTGTTGCTGACGTATTTGAAGGCATTGGTCATGTAGCCGCCGCCGCAGCCGTCGTTGTCTGTCACACAGTCCACCAGGTTCTGGGGGCTGAGCGAGCGCAGCGTGCCCGTGGTCTTCTTCAGCTGGCCCTCCAGCGCCCCCACCGAACTGAACGCCCAGCACGAACCGCAAGAGCCCTGTTTTCACAGGCGTGACGTAGCCCAGCTTGCGGTAGTCGATGCTCTTGGGTAACTGCAGGTCGCCGTCGGGGATGAAAGTGTTGTTGGTGTCCCTGAAGGGGGGCACCTGTAGTCCGGTCAACTTCTCTGCCACCTCCTCTGTGGT

Function

symbol description
ctsk Predicted to enable cysteine-type endopeptidase activity. Acts upstream of or within bone development; cartilage development; and response to mechanical stimulus. Predicted to be located in apical plasma membrane and extracellular region. Predicted to be active in extracellular space and lysosome. Is expressed in several structures, including cardiovascular system; head; lateral line system; mesoderm; and pectoral fin. Human ortholog(s) of this gene implicated in pycnodysostosis. Orthologous to human CTSK (cathepsin K).

NR:

description
PREDICTED: cathepsin K-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU172360 True 405 TUCP 0.60 2 19237689 19238958

Neighbor

gene id symbol gene type direction distance location
AMCG00012474 onecut1,LOC107746960 coding upstream 128186 19100319 ~ 19109503 (+)
AMCG00012470 NA coding upstream 171776 19054640 ~ 19065913 (+)
AMCG00012465 LOC107732464 coding upstream 300211 18933584 ~ 18937478 (+)
AMCG00012464 tnfaip8l2,LOC106605333,LOC105031250,LOC106580940,LOC107587822 coding upstream 312640 18915218 ~ 18925049 (+)
AMCG00012466 LOC107741773,LOC108262134,LOC106580947,LOC108441933,LOC106605334 coding upstream 328955 18896414 ~ 18908734 (+)
AMCG00012476 NA coding downstream 32352 19271310 ~ 19273160 (+)
AMCG00012479 NA coding downstream 38758 19277716 ~ 19294096 (+)
AMCG00012481 NA coding downstream 61855 19300813 ~ 19333427 (+)
AMCG00012483 NA coding downstream 222333 19461291 ~ 19467495 (+)
AMCG00012484 NA coding downstream 237424 19476382 ~ 19483546 (+)
G137110 NA non-coding upstream 901 19234410 ~ 19236788 (+)
G137080 NA non-coding upstream 76546 19139125 ~ 19161143 (+)
G137079 NA non-coding upstream 111376 19125841 ~ 19126313 (+)
G137074 NA non-coding upstream 122827 19112770 ~ 19114862 (+)
G137027 NA non-coding upstream 211684 19020158 ~ 19026005 (+)
G137130 NA non-coding downstream 83048 19322006 ~ 19322259 (+)
G137144 NA non-coding downstream 122386 19361344 ~ 19395753 (+)
G137155 NA non-coding downstream 184595 19423553 ~ 19425538 (+)
G137177 NA non-coding downstream 265925 19504883 ~ 19509198 (+)
G137196 NA non-coding downstream 420788 19659746 ~ 19689785 (+)
G137083 NA other upstream 63268 19169748 ~ 19174421 (+)
AMCG00012471 NA other upstream 183860 19047497 ~ 19053829 (+)
AMCG00012460 NA other upstream 693199 18539545 ~ 18544490 (+)
G136864 psmb4 other upstream 849383 18385289 ~ 18388306 (+)
AMCG00012439 NA other upstream 1103308 18130284 ~ 18134381 (+)
AMCG00012480 NA other downstream 93370 19332328 ~ 19350202 (+)
G137252 NA other downstream 575967 19814925 ~ 19815617 (+)
G137265 txnip,LOC106943536,LOC106570200,LOC105012721 other downstream 652209 19891167 ~ 19895599 (+)
AMCG00012512 NA other downstream 1007693 20246651 ~ 20270919 (+)
AMCG00012516 NA other downstream 1092123 20331081 ~ 20344646 (+)

Expression


Co-expression Network