G2076


Basic Information

Item Value
gene id G2076
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 3241671 ~ 3241939 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU2323
CCTGAATGCCACCAGGGAGGCTGACCTGGCTTCTAGCTGAACTAGTAACCTAGTCTGCTGACAACCTGTCTGTTTCCTCAGAAACAGAGTCTCTAGACACAGAAGTCTCACGAAGAGACATCCAGAAAGAGGGACTGCAGAAAGGGCAGTAGACCAACTCAGACCGGATCTTAGAGACGAGCATCCTGGAGAGCAGGACTCAGCGAAGTGCTATTGACCCTTGCAAGCGAGGGGAGTATATCTGCTCGATCCTAGGATCTACAAAGCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU2323 True 269 lncRNA 0.49 1 3241671 3241939

Neighbor

gene id symbol gene type direction distance location
CI01000000_03235219_03236826 NA coding downstream 4082 3234448 ~ 3237589 (-)
CI01000000_03195338_03205585 RNF44 coding downstream 35951 3194997 ~ 3205720 (-)
CI01000000_03172562_03175863 HIGD2A coding downstream 65808 3170391 ~ 3175863 (-)
CI01000000_03129624_03148993 PDLIM7 coding downstream 92678 3129464 ~ 3148993 (-)
CI01000000_03118493_03127143 PDLIM7 coding downstream 114449 3117708 ~ 3127222 (-)
CI01000000_03245643_03246684 NA coding upstream 3436 3245134 ~ 3246721 (-)
CI01000000_03260989_03265875 SNCB coding upstream 19050 3260989 ~ 3266142 (-)
CI01000000_03267149_03267334 NA coding upstream 24559 3266498 ~ 3267484 (-)
CI01000000_03564077_03564373 NA coding upstream 320948 3562887 ~ 3567571 (-)
CI01000000_03584834_03629968 CTNNA1 coding upstream 342325 3584264 ~ 3630022 (-)
G2075 NA non-coding downstream 54 3241286 ~ 3241617 (-)
G2070 NA non-coding downstream 57706 3183698 ~ 3183965 (-)
G2069 NA non-coding downstream 58553 3182848 ~ 3183118 (-)
G1993 NA non-coding downstream 261810 2979190 ~ 2979861 (-)
G1928 NA non-coding downstream 359589 2881760 ~ 2882082 (-)
G2078 NA non-coding upstream 26808 3268747 ~ 3269009 (-)
G2079 NA non-coding upstream 28254 3270193 ~ 3270418 (-)
G2085 NA non-coding upstream 32667 3274606 ~ 3274835 (-)
G2110 NA non-coding upstream 65545 3307484 ~ 3307695 (-)
G2131 NA non-coding upstream 94360 3336299 ~ 3337047 (-)
G1270 NA other downstream 1263335 1924081 ~ 1978336 (-)
CI01000000_01357072_01359013 NA other downstream 1881733 1355476 ~ 1359013 (-)
G1077 NA other downstream 1890493 1332179 ~ 1351178 (-)
CI01000000_00683745_00689383 NA other downstream 2552218 682205 ~ 689610 (-)
G2484 NA other upstream 328127 3570066 ~ 3573554 (-)
CI01000000_04079738_04081018 MIF other upstream 836182 4078121 ~ 4081117 (-)
G2730 NA other upstream 1144444 4386383 ~ 4390152 (-)

Expression


Co-expression Network