G2223


Basic Information

Item Value
gene id G2223
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 3579993 ~ 3580225 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU2487
ATCATTTGTTGTAGCATAACAGGAAGCCGGGAGAATGCTCTCACAATTGATTGAACTGTCAAAAAACACGTTGTTTGATTGATCACATTTCAACCAATCATGTCATGCCAATTTTAGATGCGATCGGGTTGGCTGACAGATCCTGGTAGAGAAAATACAAGAATTCAAGGTGAGGTGATACTGTTACACTTCAAGTTTGAAACTTAAATTTCCCTAAAAATACAGCTTTTTTT

Function

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU2487 True 233 lncRNA 0.36 1 3579993 3580225

Neighbor

gene id symbol gene type direction distance location
CI01000000_03232984_03233709 NA coding upstream 346004 3232984 ~ 3233989 (+)
CI01000000_03220166_03232503 NA coding upstream 347490 3220166 ~ 3232503 (+)
CI01000000_03184726_03189468 FAF2 coding upstream 390525 3184680 ~ 3189468 (+)
CI01000000_03178021_03180730 NA coding upstream 399181 3178021 ~ 3180812 (+)
CI01000000_03163645_03170599 CLTB coding upstream 408982 3163157 ~ 3171011 (+)
CI01000000_03630643_03637287 LRRTM2 coding downstream 50366 3630591 ~ 3638076 (+)
CI01000000_03724666_03729920 MCHR2 coding downstream 143875 3724100 ~ 3730043 (+)
CI01000000_03864153_03869858 NA coding downstream 283928 3864137 ~ 3870246 (+)
CI01000000_03919871_03926839 NA coding downstream 338009 3918234 ~ 3926911 (+)
CI01000000_03930421_03932454 NA coding downstream 350196 3930421 ~ 3933213 (+)
G2206 NA non-coding upstream 59109 3520682 ~ 3520884 (+)
G2205 NA non-coding upstream 59935 3519706 ~ 3520058 (+)
G2167 NA non-coding upstream 183762 3396006 ~ 3396231 (+)
G2161 NA non-coding upstream 191769 3387952 ~ 3388224 (+)
G2151 NA non-coding upstream 207163 3372415 ~ 3372830 (+)
G2204 NA non-coding downstream 84624 3664849 ~ 3688189 (+)
G2283 NA non-coding downstream 118879 3699104 ~ 3699367 (+)
G2319 NA non-coding downstream 161483 3741708 ~ 3741934 (+)
G2320 NA non-coding downstream 164348 3744573 ~ 3744823 (+)
G2337 NA non-coding downstream 223061 3803286 ~ 3803749 (+)
G579 NA other upstream 1671185 1767917 ~ 1908808 (+)
G435 NA other upstream 2147139 1425121 ~ 1432854 (+)
G350 NA other upstream 2903056 671842 ~ 676937 (+)
G252 NA other upstream 3072921 503209 ~ 507072 (+)
G2774 NA other downstream 873553 4453778 ~ 4454232 (+)
G2850 NA other downstream 1145761 4725986 ~ 4726482 (+)
G6811 NA other downstream 6624606 10204831 ~ 10321679 (+)
G6820 NA other downstream 6846998 10427223 ~ 10433018 (+)
G7018 NA other downstream 7398264 10978489 ~ 10980872 (+)

Expression


Co-expression Network