G2354


Basic Information

Item Value
gene id G2354
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000000
NCBI id null
chromosome length 19091038
location 3827698 ~ 3827975 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU2625
CAGACTTCTAGTTCCCAGCATGCTTTGCTTCTGACTGTTAAAGGAGAGTAAATGTTAAAATTAAGCGCTATTTCATGTGTTTTACTCAATATTGATATAGGGGGAGATCTGTTAGTGTTTAAAGTTGTATTATTTTGGAATTTAAAAGGTTTTCTGGTATGTGTGAGTTTTTGGGGTTACCATTGTGCTGAAGAGTAGAGCCTGTGGTTAGGTTTATGATTGACTGAACACCATTAAGACTATAATAACTTTATTTAAAAAGTAACAGCTGTGCACGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU2625 True 278 lncRNA 0.34 1 3827698 3827975

Neighbor

gene id symbol gene type direction distance location
CI01000000_03724666_03729920 MCHR2 coding upstream 97655 3724100 ~ 3730043 (+)
CI01000000_03630643_03637287 LRRTM2 coding upstream 189622 3630591 ~ 3638076 (+)
CI01000000_03232984_03233709 NA coding upstream 593709 3232984 ~ 3233989 (+)
CI01000000_03220166_03232503 NA coding upstream 595195 3220166 ~ 3232503 (+)
CI01000000_03184726_03189468 FAF2 coding upstream 638230 3184680 ~ 3189468 (+)
CI01000000_03864153_03869858 NA coding downstream 36178 3864137 ~ 3870246 (+)
CI01000000_03919871_03926839 NA coding downstream 90259 3918234 ~ 3926911 (+)
CI01000000_03930421_03932454 NA coding downstream 102446 3930421 ~ 3933213 (+)
CI01000000_03962507_03966711 N4BP3 coding downstream 134336 3962311 ~ 3966796 (+)
CI01000000_04019072_04022985 PPP2CA.L, PP2AA, PPP2CB, PPP2CA coding downstream 191097 4019072 ~ 4023055 (+)
G2351 NA non-coding upstream 5332 3822127 ~ 3822366 (+)
G2342 NA non-coding upstream 14501 3812942 ~ 3813197 (+)
G2337 NA non-coding upstream 23949 3803286 ~ 3803749 (+)
G2320 NA non-coding upstream 82875 3744573 ~ 3744823 (+)
G2319 NA non-coding upstream 85764 3741708 ~ 3741934 (+)
G2293 NA non-coding downstream 44465 3872440 ~ 3875696 (+)
G2385 NA non-coding downstream 156489 3984464 ~ 3984820 (+)
CI01000000_04076566_04077988 NA non-coding downstream 248552 4076018 ~ 4078074 (+)
CI01000000_04090995_04093696 SCOC, SCOCB non-coding downstream 262460 4090547 ~ 4093745 (+)
G579 NA other upstream 1918890 1767917 ~ 1908808 (+)
G435 NA other upstream 2394844 1425121 ~ 1432854 (+)
G350 NA other upstream 3150761 671842 ~ 676937 (+)
G252 NA other upstream 3320626 503209 ~ 507072 (+)
G2774 NA other downstream 625803 4453778 ~ 4454232 (+)
G2850 NA other downstream 898011 4725986 ~ 4726482 (+)
G6811 NA other downstream 6376856 10204831 ~ 10321679 (+)
G6820 NA other downstream 6599248 10427223 ~ 10433018 (+)
G7018 NA other downstream 7150514 10978489 ~ 10980872 (+)

Expression


Co-expression Network