G149949 (crygs1,LOC107756035,LOC107586953)


Basic Information

Item Value
gene id G149949
gene name crygs1,LOC107756035,LOC107586953
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056720.1
NCBI id CM032089.1
chromosome length 18002998
location 6319805 ~ 6320041 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU221901
ATCATCTTGCAGGAGCAGAGGCGGTCGTTCAGACCCATCCAGCGCTGGTAATCCGGATACTCGCCCCGGGTCAGAACATACTGGTAGCCCATGAAGTTGGGCCTCTCGTAGACCACCCAGGCCCCGCTCTCCACACGGATGGAGTTACACCGGTTCAGGTAGGCATGGAAGTCCGAACAGTCGCTGTCGCACTCGTACCGACGGCCCTGGAAGTTCTTGTCCTCGTAGAAAATTATC

Function

symbol description
crygs1 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in eye and lens. Human ortholog(s) of this gene implicated in cataract 20 multiple types. Orthologous to human CRYGS (crystallin gamma S).

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU221901 True 237 lncRNA 0.57 1 6319805 6320041

Neighbor

gene id symbol gene type direction distance location
LOC122327481 NA coding upstream 3509 6314884 ~ 6316296 (+)
LOC122327484 NA coding upstream 7247 6310669 ~ 6312558 (+)
sgsh sgsh,sphm,LOC107756031,LOC107704414 coding upstream 84445 6231272 ~ 6235360 (+)
bcor bcor,LOC107756025,LOC107745971,LOC107593046 coding upstream 249885 6022006 ~ 6069920 (+)
LOC122327535 NA coding upstream 311619 6006482 ~ 6008186 (+)
LOC122328229 krt97,krt96,LOC107663680,LOC107745983,LOC107739339,LOC107593038 coding downstream 24080 6344121 ~ 6347334 (+)
mrasb mras,rasm,LOC107663675,LOC107587007,LOC107653555,LOC107593037,LOC108425734 coding downstream 57651 6377692 ~ 6385265 (+)
mgat5 mgat5,LOC107745986,LOC107739338,LOC107663499,LOC107653587 coding downstream 99617 6419658 ~ 6472721 (+)
LOC122327191 r3hdm1,LOC107586957,LOC107739334,LOC107593074 coding downstream 258966 6579007 ~ 6618908 (+)
rnd3a rnd3a,LOC107600972,LOC107710934,LOC107653593,LOC107586959,LOC107687879,LOC108425727 coding downstream 318171 6638212 ~ 6649011 (+)
G149948 NA non-coding upstream 464 6318985 ~ 6319341 (+)
G149913 NA non-coding upstream 96022 6223257 ~ 6223783 (+)
G149892 NA non-coding upstream 128415 6189117 ~ 6191390 (+)
G149891 mid1ip1b,LOC107756028,LOC107663600,LOC107704421,LOC107593044,LOC107745972,LOC107586944 non-coding upstream 131935 6185969 ~ 6187870 (+)
LOC122327601 NA non-coding upstream 159082 6115049 ~ 6160723 (+)
G150294 NA non-coding downstream 27377 6347418 ~ 6349670 (+)
G150296 NA non-coding downstream 32721 6352762 ~ 6353668 (+)
G150300 NA non-coding downstream 43564 6363605 ~ 6365101 (+)
G150378 NA non-coding downstream 413245 6733286 ~ 6734808 (+)
G150408 glsa,LOC107586966,LOC107687871,LOC107754246,LOC107653599,LOC107600978,LOC107739327 non-coding downstream 508463 6828504 ~ 6831372 (+)
npb npb,LOC107663585,LOC107587005,LOC107756033,LOC107704419,LOC107593099 other upstream 80448 6236117 ~ 6239357 (+)
G149895 NA other upstream 127146 6191647 ~ 6192659 (+)
LOC122327524 NA other upstream 307124 5923907 ~ 6012681 (+)
lsm7 lsm7,LOC107593053,LOC107704434 other upstream 471219 5847131 ~ 5848586 (+)
hyal2b hyal2b,LOC107695624,LOC107756016,LOC107586928,LOC107704436,LOC107593055 other upstream 495703 5810478 ~ 5824102 (+)
ccnt2b ccnt2b,LOC107593034,LOC107663476,LOC107739335,LOC107586955,LOC107653589,LOC107745988 other downstream 182873 6502914 ~ 6510456 (+)
G150369 NA other downstream 388447 6708488 ~ 6708891 (+)
G150756 NA other downstream 1847408 8167449 ~ 8168272 (+)
G150862 s1pr1,LOC107715096,LOC107592715,LOC107669844,LOC107653630,LOC107588065 other downstream 2294248 8614289 ~ 8617605 (+)
pdzk1ip1 NA other downstream 2570581 8890622 ~ 8892199 (+)

Expression


Co-expression Network