G15798


Basic Information

Item Value
gene id G15798
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 5003170 ~ 5003390 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17657
GACCAAAGGTTCAGCATATGACGGGATTATGTTAATCTGTAAGAGAAAGAGAAATAATCAGATCTCCATTGATGCTACAACTTAGTGAACTTACAAAAAAAGAGTGCCCCACCTTCACACCCGAGTTAAACATTGTTTCGTTGACATGCATAAATACATAGGCTTAACAAGGACACTGTAAAATATATTTTTTATTTTAGTTGGAAGTAGATGCCATCTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17657 True 221 lncRNA 0.36 1 5003170 5003390

Neighbor

gene id symbol gene type direction distance location
CI01000001_04993860_04998535 NA coding upstream 4409 4993860 ~ 4998761 (+)
CI01000001_04976994_04988795 NFASCB coding upstream 14088 4976347 ~ 4989082 (+)
CI01000001_04962494_04971921 NA coding upstream 30939 4962494 ~ 4972231 (+)
CI01000001_04950531_04960550 NACA, NACA.2 coding upstream 42475 4950531 ~ 4960695 (+)
CI01000001_04936808_04943256 PRIM1 coding upstream 59715 4936808 ~ 4943455 (+)
CI01000001_05051664_05059659 MFSD4B coding downstream 48139 5051529 ~ 5059940 (+)
CI01000001_05071017_05075175 NA coding downstream 65913 5069303 ~ 5075753 (+)
CI01000001_05075984_05079729 NA coding downstream 72594 5075934 ~ 5079731 (+)
CI01000001_05223340_05229184 IDH3G coding downstream 219950 5223340 ~ 5229659 (+)
CI01000001_05270301_05279405 AVPR2AB coding downstream 266911 5270301 ~ 5280807 (+)
G15789 NA non-coding upstream 67180 4935371 ~ 4935990 (+)
G15419 NA non-coding upstream 201640 4800973 ~ 4801530 (+)
G15416 NA non-coding upstream 205376 4797476 ~ 4797794 (+)
G15395 NA non-coding upstream 244751 4753717 ~ 4758419 (+)
G15389 NA non-coding upstream 276430 4598677 ~ 4726740 (+)
G15800 NA non-coding downstream 2432 5005822 ~ 5006037 (+)
G15812 NA non-coding downstream 37976 5041366 ~ 5041565 (+)
G15817 NA non-coding downstream 57417 5060807 ~ 5061182 (+)
G15796 NA non-coding downstream 67082 5074401 ~ 5074805 (+)
CI01000001_03618075_03620436 NA other upstream 1381719 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 3332166 1667762 ~ 1671167 (+)
G13051 NA other upstream 3958018 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 4511113 483853 ~ 488825 (+)
G12614 NA other upstream 4692229 309144 ~ 310941 (+)
G15794 NA other downstream 57828 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 283359 5279837 ~ 5287698 (+)
G15995 NA other downstream 708495 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 2529182 7531541 ~ 7540586 (+)
G17234 NA other downstream 3028734 8032124 ~ 8032483 (+)

Expression


Co-expression Network