G16497


Basic Information

Item Value
gene id G16497
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 5350668 ~ 5350915 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU18479
GGTTATGTGGGCACCATTTCCTGTGAGGTGCGAACTTATTGAAAAACTCGTTGTACCCTGCTCTTATCGTATGCATAACAATAATGGAGCTAATGAGCTACATAAATATTTGCACATCCAGTGAATATTAGATCTGACAGATAAGTCATTAGCACATGACATCGCGCGCGTGGTGTTGGTAGAATAGAATGATAAACGACGACGTTTTAAAAAGTTTAACTTCGACGCGGCGTAAAGGTCAACGGTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU18479 True 248 lncRNA 0.42 1 5350668 5350915

Neighbor

gene id symbol gene type direction distance location
CI01000001_05318747_05341451 ARHGAP4B coding downstream 8895 5317514 ~ 5341773 (-)
CI01000001_05313109_05313728 NA coding downstream 36940 5313056 ~ 5313728 (-)
CI01000001_05295894_05308912 SSR4, SSRD, IKBKG coding downstream 41682 5295523 ~ 5308986 (-)
CI01000001_05288832_05293421 SEPHS2, SPS2 coding downstream 57247 5286756 ~ 5293421 (-)
CI01000001_05205733_05220435 FAM120C coding downstream 129053 5204576 ~ 5221615 (-)
CI01000001_05355269_05356224 NA coding upstream 3796 5354711 ~ 5357715 (-)
CI01000001_05387081_05398706 TRPC4AP coding upstream 35512 5386427 ~ 5398706 (-)
CI01000001_05403970_05409286 NSFL1C coding upstream 53055 5403970 ~ 5409286 (-)
CI01000001_05436238_05437581 FAM110A coding upstream 84890 5435805 ~ 5437655 (-)
CI01000001_05437862_05438101 NA coding upstream 86788 5437703 ~ 5438101 (-)
G16461 NA non-coding downstream 99162 5232386 ~ 5251506 (-)
G16459 NA non-coding downstream 161026 5189281 ~ 5189642 (-)
G16400 NA non-coding downstream 272127 5078342 ~ 5078541 (-)
G16390 NA non-coding downstream 291741 5058690 ~ 5058927 (-)
G16388 NA non-coding downstream 296578 5051494 ~ 5054090 (-)
G16509 NA non-coding upstream 63335 5414250 ~ 5414495 (-)
G16512 NA non-coding upstream 68026 5418941 ~ 5419396 (-)
G16514 NA non-coding upstream 108877 5459792 ~ 5460018 (-)
G16515 NA non-coding upstream 111091 5462006 ~ 5462271 (-)
G16518 NA non-coding upstream 117203 5468118 ~ 5468464 (-)
G16462 NA other downstream 121083 5222777 ~ 5229585 (-)
G16332 NA other downstream 392826 4950689 ~ 4957842 (-)
G15736 NA other downstream 549273 4800901 ~ 4801395 (-)
CI01000001_04726550_04727511 PDPFB, PPDPFB, PPDPF other downstream 622461 4725927 ~ 4728210 (-)
CI01000001_04468566_04523431 DNMT3BB.1 other downstream 872523 4468209 ~ 4523431 (-)
G16664 NA other upstream 993189 6344104 ~ 6347955 (-)
G16753 NA other upstream 1233565 6583054 ~ 6615589 (-)
G17789 NA other upstream 1486610 6837525 ~ 6890414 (-)
CI01000001_06932075_06937182 NA other upstream 1585162 6931621 ~ 6937231 (-)
G17911 NA other upstream 1900396 7251311 ~ 7267952 (-)

Expression


Co-expression Network