G18967


Basic Information

Item Value
gene id G18967
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 10434219 ~ 10434542 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU21301
CAATGTTGGAAACAGTTGTGCTGCTTAATATTATTTTATAACCTGTGATACTTTTTCAGGATTCATTGATGAATAAAAAGTTAAAAAATATCAGCATTTATTTAAAATAGAAATCTTTTGTAACAATATACACTACCGTTCAAAAGTTTGAGGACAGTCATTTTGAATGAAAGAAATTAATACTTTTATTCAGCACAGATGTGTTAAATTGATAAAAAGTGATAGTAAAGATTTATATTGTTAGAAAAGATTTATATTTTGAATAAATGCTGTTCTTTTTAACCTTTTATTCATCAATGAATCCTGAAAAAAGTATCACAGGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU21301 True 324 lncRNA 0.40 1 10434219 10434542

Neighbor

gene id symbol gene type direction distance location
CI01000001_10420931_10426716 NA coding upstream 7072 10420318 ~ 10427147 (+)
CI01000001_10395420_10396473 NA coding upstream 37746 10394851 ~ 10396705 (+)
CI01000001_10328133_10329110 NA coding upstream 105109 10328040 ~ 10329110 (+)
CI01000001_10321783_10325266 NA coding upstream 108914 10321647 ~ 10325305 (+)
CI01000001_10150798_10152858 MIPA coding upstream 281281 10150373 ~ 10152938 (+)
CI01000001_10525795_10530510 WNT1 coding downstream 88720 10523262 ~ 10530543 (+)
CI01000001_10538498_10539667 RPS26 coding downstream 103846 10538388 ~ 10539846 (+)
CI01000001_10573770_10582123 LMBR1L coding downstream 139228 10573770 ~ 10582238 (+)
CI01000001_10582439_10582802 NA coding downstream 147836 10582378 ~ 10582821 (+)
CI01000001_10590766_10595793 DHH coding downstream 155894 10590436 ~ 10596238 (+)
G18951 NA non-coding upstream 459 10431957 ~ 10433760 (+)
G18882 NA non-coding upstream 30309 10402230 ~ 10403910 (+)
G18876 NA non-coding upstream 42621 10390688 ~ 10391598 (+)
G18878 NA non-coding upstream 90098 10340037 ~ 10344121 (+)
G18880 NA non-coding upstream 96070 10336887 ~ 10338149 (+)
G18968 NA non-coding downstream 1228 10435770 ~ 10435995 (+)
G18969 NA non-coding downstream 2111 10436653 ~ 10436873 (+)
G18929 NA non-coding downstream 2784 10437326 ~ 10440371 (+)
G18933 NA non-coding downstream 50606 10485148 ~ 10487561 (+)
G19011 NA non-coding downstream 64091 10498633 ~ 10500815 (+)
G18872 NA other upstream 152850 10271146 ~ 10281369 (+)
G18873 NA other upstream 173505 10223879 ~ 10260714 (+)
G18896 NA other upstream 192727 10239900 ~ 10241492 (+)
CI01000001_09435836_09436037 NA other upstream 996156 9435836 ~ 9436373 (+)
G18937 NA other downstream 40442 10474984 ~ 10476389 (+)
G19039 NA other downstream 416382 10850924 ~ 10853983 (+)
G19314 NA other downstream 1066652 11501194 ~ 11558673 (+)
G19395 NA other downstream 1246780 11681322 ~ 11681817 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G1550122 NA non-coding NC_048582.1 CM023236.2 42345906 ~ 42347312 (-)