G28790


Basic Information

Item Value
gene id G28790
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 7821817 ~ 7822017 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32552
TTTTAATGTAAATGTTTCTTAATAAGAACAATTCTCAGTTCCCAACTTTAATGAAGAAAAAACTTTCTGTCTGCCAGGTGTAGTTAGATGTCGGGTCTACCCAGATGTGTCATGATGCATATCATATTTAATATTTAATGCTAGCTCAAAGTATTGTTTAGTTATAGCTCTTTGGTTTGTTAATAAATGCAGCTACTTGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32552 True 201 lncRNA 0.42 1 7821817 7822017

Neighbor

gene id symbol gene type direction distance location
CI01000004_07775338_07780352 ANGPTL4 coding upstream 40499 7775242 ~ 7781318 (+)
CI01000004_07759670_07760529 RPS28P9, RPS28 coding upstream 60820 7759509 ~ 7761023 (+)
CI01000004_07712175_07712384 NA coding upstream 109415 7712175 ~ 7712402 (+)
CI01000004_07686845_07692184 NR2F6, NR2F6A, NR2F6B coding upstream 128735 7686018 ~ 7693082 (+)
CI01000004_07654234_07655677 MRPL34 coding upstream 166036 7654234 ~ 7656383 (+)
CI01000004_07823292_07824588 NA coding downstream 819 7822836 ~ 7826203 (+)
CI01000004_07843003_07860951 NA coding downstream 20986 7843003 ~ 7862424 (+)
CI01000004_07868939_07899539 PIK3R2 coding downstream 46603 7868620 ~ 7900206 (+)
CI01000004_07903583_07906667 NA coding downstream 81566 7903583 ~ 7906670 (+)
CI01000004_07907663_07910335 MPV17L2 coding downstream 85646 7907663 ~ 7910478 (+)
G28784 NA non-coding upstream 17164 7804266 ~ 7804653 (+)
G28780 NA non-coding upstream 55428 7765563 ~ 7766389 (+)
G28779 NA non-coding upstream 57106 7764512 ~ 7764711 (+)
G28757 NA non-coding upstream 68435 7753066 ~ 7753382 (+)
G28791 NA non-coding downstream 5351 7827368 ~ 7827682 (+)
G28797 NA non-coding downstream 161464 7983481 ~ 7983777 (+)
G28800 NA non-coding downstream 203474 8025491 ~ 8025898 (+)
G28801 NA non-coding downstream 206233 8028250 ~ 8033712 (+)
G28819 NA non-coding downstream 455185 8277202 ~ 8284097 (+)
CI01000004_06571261_06572539 SEP15 other upstream 1247396 6570771 ~ 6572667 (+)
G28302 NA other upstream 1319730 6470028 ~ 6502087 (+)
G28165 NA other upstream 2088816 5732589 ~ 5733001 (+)
G27805 NA other upstream 2448014 5372825 ~ 5373803 (+)
CI01000004_08414451_08436256 NA other downstream 611688 8414316 ~ 8439933 (+)
G28859 NA other downstream 777218 8599235 ~ 8599603 (+)
CI01000004_08976512_08980033 TTPA other downstream 1154421 8976254 ~ 8980984 (+)
G30797 NA other downstream 2675359 10497376 ~ 10497788 (+)
G31710 NA other downstream 3815234 11637251 ~ 11642400 (+)

Expression


Co-expression Network