G30787


Basic Information

Item Value
gene id G30787
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10474750 ~ 10474951 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU34802
TGAAAATGGCTAAAGACTAGGCAGCTCGGGTTGAGTTAAGCAGGTCATTCCACCAGCTTGGAACAGTCAAGGTAGAGGTCCGTGAAAGTGATTTTCTGCCTCTTTGGGATGGCAACACAAAGCGCCATCCACTTGCAGAACGCAAGCTTCTGGAGGGCACATAGGTCTTAAGTAGTGAGTTTATGTATAGGAGTGCAGAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU34802 True 202 lncRNA 0.40 1 10474750 10474951

Neighbor

gene id symbol gene type direction distance location
CI01000004_10434104_10435287 PTF1A coding upstream 39181 10431833 ~ 10435569 (+)
CI01000004_10376389_10423302 DLGAP1A, DLGAP1 coding upstream 51448 10376389 ~ 10423302 (+)
CI01000004_10169407_10212947 CDH18 coding upstream 261561 10169407 ~ 10213189 (+)
CI01000004_10058538_10090881 CDH12A coding upstream 383701 10058538 ~ 10091049 (+)
CI01000004_09980195_09995816 CDH10A coding upstream 478857 9980195 ~ 9995893 (+)
CI01000004_10514814_10550774 NA coding downstream 39863 10514814 ~ 10550920 (+)
CI01000004_10582152_10586349 HTR5AB, HTR5A, HTR5AA coding downstream 107170 10582121 ~ 10586553 (+)
CI01000004_10610634_10613290 ENG2B coding downstream 134829 10609780 ~ 10613630 (+)
CI01000004_10630265_10647904 NA coding downstream 155314 10630265 ~ 10647904 (+)
CI01000004_10683400_10692323 NA coding downstream 208449 10683400 ~ 10692565 (+)
G30780 NA non-coding upstream 20490 10453602 ~ 10454260 (+)
G30688 NA non-coding upstream 27013 10436230 ~ 10447737 (+)
G30681 NA non-coding upstream 129772 10208466 ~ 10344978 (+)
G30515 NA non-coding upstream 568204 9906238 ~ 9906546 (+)
G30689 NA non-coding downstream 218966 10693917 ~ 10697207 (+)
G30839 NA non-coding downstream 226273 10701224 ~ 10701436 (+)
G30678 NA non-coding downstream 257436 10732387 ~ 10736123 (+)
G30861 NA non-coding downstream 275883 10750834 ~ 10751295 (+)
G30863 NA non-coding downstream 279006 10753957 ~ 10754306 (+)
CI01000004_08976512_08980033 TTPA other upstream 1493766 8976254 ~ 8980984 (+)
G28859 NA other upstream 1875147 8599235 ~ 8599603 (+)
CI01000004_08414451_08436256 NA other upstream 2023523 8414316 ~ 8439933 (+)
CI01000004_07654234_07655677 MRPL34 other upstream 2818367 7654234 ~ 7656383 (+)
CI01000004_06571261_06572539 SEP15 other upstream 3900329 6570771 ~ 6572667 (+)
G30797 NA other downstream 22425 10497376 ~ 10497788 (+)
G31710 NA other downstream 1162300 11637251 ~ 11642400 (+)
CI01000004_11666900_11667179 NA other downstream 1189822 11666900 ~ 11667659 (+)
G31865 NA other downstream 1717179 12192130 ~ 12197418 (+)
CI01000004_12646972_12652534 NA other downstream 2167803 12646838 ~ 12652570 (+)

Expression


Co-expression Network