G34711



Basic Information


Item Value
gene id G34711
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15259444 ~ 15259772 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU39404
GGGGAACACTACTTTTGCCTCAATAAACTCTTTATTTACTGCTCATTAATAGTAAGGTAGTTGTTGTAGCATTTAAGTTTAGGTATGGGGTAGGATTTAGGGATGTAGAACAGTGTTGGGGGTAACGCATTACAAGTAACTTGAGTTATGTAATCAGATTACTTTTTTAAGTAACTAGTAAAGTAACGCATTACTTTTTCAATTTACAACAAAATATCTGAGTTACTTTTTAAAATTTTTGGACTGACAGCTCTCCTGTCCCCATGTTGAGAGAAATAAAGTGCAGAGGTGTTGTATGCGCTGTGTAAACATGATGGTTATTGTAGTTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU39404 True 329 lncRNA 0.35 1 15259444 15259772

Neighbor


gene id symbol gene type direction distance location
CI01000004_15255165_15256033 APODA.1 coding downstream 1217 15254943 ~ 15258227 (-)
CI01000004_15217903_15228632 NA coding downstream 30708 15217738 ~ 15228736 (-)
CI01000004_15186236_15193312 NA coding downstream 63984 15185939 ~ 15195460 (-)
CI01000004_15159447_15160043 DIRAS1A, DIRAS1B, DIRAS1, DIRAS2 coding downstream 99401 15159408 ~ 15160043 (-)
CI01000004_15086759_15087492 NA coding downstream 171911 15086671 ~ 15087575 (-)
CI01000004_15300222_15308848 NADK, NADKB coding upstream 39888 15299660 ~ 15308941 (-)
CI01000004_15326982_15360355 SKILA coding upstream 67087 15326859 ~ 15360355 (-)
CI01000004_15370117_15389832 PRKCI coding upstream 109982 15369754 ~ 15389832 (-)
CI01000004_15416876_15425066 NA coding upstream 157104 15416876 ~ 15425164 (-)
CI01000004_15429682_15430354 NA coding upstream 168746 15428518 ~ 15431049 (-)
G34572 NA non-coding downstream 5264 15246506 ~ 15254180 (-)
G34646 NA non-coding downstream 35502 15223661 ~ 15223942 (-)
G34701 NA non-coding downstream 79195 15179974 ~ 15180249 (-)
G34575 NA non-coding downstream 112482 15109981 ~ 15146962 (-)
G34685 NA non-coding downstream 144095 15113595 ~ 15115349 (-)
G34713 NA non-coding upstream 508 15260280 ~ 15262403 (-)
G34714 NA non-coding upstream 10922 15270694 ~ 15270899 (-)
G34717 NA non-coding upstream 20171 15279943 ~ 15280142 (-)
G34611 NA non-coding upstream 26551 15286323 ~ 15292665 (-)
G34634 NA non-coding upstream 56469 15316241 ~ 15318222 (-)
G34668 NA other downstream 206669 15051176 ~ 15052775 (-)
G34632 NA other downstream 234223 15011361 ~ 15025221 (-)
CI01000004_14827536_14831360 NA other downstream 431321 14827496 ~ 14831526 (-)
CI01000004_14808034_14808645 NA other downstream 450915 14807938 ~ 14808969 (-)
G34718 NA other upstream 21244 15281016 ~ 15281649 (-)
G34633 NA other upstream 527614 15787386 ~ 15787897 (-)
CI01000004_15832789_15836192 NA other upstream 572801 15832573 ~ 15836231 (-)
G34796 NA other upstream 600841 15860613 ~ 15863748 (-)
G34934 NA other upstream 1141973 16401745 ~ 16421506 (-)

Expression



Co-expression Network