CI01000004_15159447_15160043 (DIRAS1A, DIRAS1B, DIRAS1, DIRAS2)


Basic Information

Item Value
gene id CI01000004_15159447_15160043
gene name DIRAS1A, DIRAS1B, DIRAS1, DIRAS2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 15159408 ~ 15160043 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_15159447_15160043.mRNA
ATGCCCGAGCAGAGCAACGACTACCGTGTGGTGGTGTTTGGAGCAGGGGGTGTGGGGAAGAGCTCACTGGTGCTCCGTTTTGTCAAAGGCACTTTCCGGGACACCTACATCCCGACGGTGGAGGACACGTATCGCCAGGTGATCAGCTGTGACAAGAGCGTCTGCACCCTGCAGATCACAGACACAACTGGCAGCCACCAGTTTCCTGCCATGCAGCGTCTGTCCATCTCCAAGGGTCACGCCTTCATCCTGGTCTACTCCATCACCAGTAAGCAGTCCCTGGAAGAATTAAAGCCCATATACCAGCAGATTCTCGCCATCAAAGGCAACATAGAGAACATCCCCATCATGCTCGTGGGGAACAAGAGTGATGAGACTCAACGGGAAGTCAAGACCGAGGATGGAGAGGCACAGTCCAAGACCTGGAAGTGTGCGTTCATGGAGACCTCGGCTAAGACCAACCACAATGTCACTGAGCTGTTCCAGGAGCTCCTCAACTTGGAGAAGAAGAGGAACATGAGTTTGAACATCGACGGCAAGCGTTCTGGGAAGCAAAGCAGGGCTGACAAGCTGAAGGGGAAATGCAGCATCATGTAGAGGCAGAACCGTAACATAGCGGAGAGATAGATTAATAAA

Function

symbol description
diras1a Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Acts upstream of or within neuron development and trigeminal ganglion development. Predicted to be located in membrane. Predicted to be active in plasma membrane. Is expressed in nervous system and otic vesicle. Orthologous to human DIRAS1 (DIRAS family GTPase 1).
diras1b Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Acts upstream of or within neuron development and trigeminal ganglion development. Predicted to be located in membrane. Predicted to be active in plasma membrane. Is expressed in brain; diencephalon; hindbrain; retinal ganglion cell layer; and telencephalon. Orthologous to human DIRAS1 (DIRAS family GTPase 1).
diras1 Enables GTP binding activity and GTPase activity. Predicted to be involved in signal transduction. Located in plasma membrane.
diras2 Enables GTP binding activity. Predicted to be involved in signal transduction. Located in plasma membrane.

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process

KEGG:

id description
K07840 DIRAS1; DIRAS family, GTP-binding Ras-like 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_15159447_15160043.mRNA True 636 mRNA 0.53 1 15159408 15160043

Neighbor

gene id symbol gene type direction distance location
CI01000004_15086759_15087492 NA coding downstream 71875 15086671 ~ 15087575 (-)
CI01000004_15068206_15086386 MAP1SB coding downstream 72889 15067755 ~ 15086519 (-)
CI01000004_15063428_15066310 NA coding downstream 93098 15063428 ~ 15066310 (-)
CI01000004_14999971_15002640 SLITRK3B coding downstream 156768 14999275 ~ 15002640 (-)
CI01000004_14951433_14957539 NA coding downstream 201567 14951176 ~ 14957841 (-)
CI01000004_15186236_15193312 NA coding upstream 25896 15185939 ~ 15195460 (-)
CI01000004_15217903_15228632 NA coding upstream 57695 15217738 ~ 15228736 (-)
CI01000004_15255165_15256033 APODA.1 coding upstream 94900 15254943 ~ 15258227 (-)
CI01000004_15300222_15308848 NADK, NADKB coding upstream 139617 15299660 ~ 15308941 (-)
CI01000004_15326982_15360355 SKILA coding upstream 166816 15326859 ~ 15360355 (-)
G34575 NA non-coding downstream 12446 15109981 ~ 15146962 (-)
G34685 NA non-coding downstream 44059 15113595 ~ 15115349 (-)
G34684 NA non-coding downstream 53706 15105465 ~ 15105702 (-)
G34674 NA non-coding downstream 97611 15061471 ~ 15061797 (-)
G34673 NA non-coding downstream 102796 15056278 ~ 15056612 (-)
G34701 NA non-coding upstream 19931 15179974 ~ 15180249 (-)
G34646 NA non-coding upstream 63618 15223661 ~ 15223942 (-)
G34572 NA non-coding upstream 86463 15246506 ~ 15254180 (-)
G34711 NA non-coding upstream 99401 15259444 ~ 15259772 (-)
G34713 NA non-coding upstream 100237 15260280 ~ 15262403 (-)
G34668 NA other downstream 106633 15051176 ~ 15052775 (-)
G34632 NA other downstream 134187 15011361 ~ 15025221 (-)
CI01000004_14827536_14831360 NA other downstream 331285 14827496 ~ 14831526 (-)
CI01000004_14808034_14808645 NA other downstream 350879 14807938 ~ 14808969 (-)
G34718 NA other upstream 120973 15281016 ~ 15281649 (-)
G34633 NA other upstream 627343 15787386 ~ 15787897 (-)
CI01000004_15832789_15836192 NA other upstream 672530 15832573 ~ 15836231 (-)
G34796 NA other upstream 700570 15860613 ~ 15863748 (-)
G34934 NA other upstream 1241702 16401745 ~ 16421506 (-)

Expression


Co-expression Network