G34323


Basic Information

Item Value
gene id G34323
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 16449680 ~ 16455626 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU38891
GCTGACAAAACTTCTATCAGTTTGGAAGAATCTCTAGAACCTTGATCCGGCTTGGATCATAAATACAGTCCTCTTCTAATCCACTGAGAACCATTCCACAGTTCGCAGGGACCCACGCAGTGTCATAACCATGTTGATTCCAGGTTTTCTGTAAAGGATGACCCTGACAATTGATCTTCTTCACTTTTCCCACTCGAACACTTAGTTTAAGAATGGCCAGCTGTTGTCCTCCAGCATTTATAGGGTAACGAGAAGCTTTCTCTTTACTCCGGCTCACATAGACTCCTGGCCCGAGCATCCCATCAGAAGAGGGTCTGAATCCTTCACGTTGGATCTTTTGTGCGTTTACCATCGTAGTGCCGTGGTACATGATGTATGTTCTCCGTCCAGGATACCTCTGTATTCCAGTGTCATAATCGTTGTCCCCCATGGCATTCACAGTAACCAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU38891 True 449 lncRNA 0.48 2 16449680 16455626

Neighbor

gene id symbol gene type direction distance location
CI01000004_16407140_16438873 NA coding upstream 10430 16406985 ~ 16439250 (+)
CI01000004_16346680_16401924 NA coding upstream 47756 16346680 ~ 16401924 (+)
CI01000004_16221780_16232426 PSMB5 coding upstream 216740 16221780 ~ 16232940 (+)
CI01000004_16217935_16218580 NA coding upstream 231100 16217853 ~ 16218580 (+)
CI01000004_16138496_16143438 NA coding upstream 305563 16138496 ~ 16144117 (+)
CI01000004_16467711_16471121 NA coding downstream 12085 16467711 ~ 16471507 (+)
CI01000004_16490931_16555397 CARMIL3, LRRC16B coding downstream 35305 16490931 ~ 16555993 (+)
CI01000004_16567132_16570668 NA coding downstream 111506 16567132 ~ 16571368 (+)
CI01000004_16579927_16586961 NA coding downstream 124301 16579927 ~ 16587197 (+)
CI01000004_16649360_16654303 NA coding downstream 193545 16649171 ~ 16654353 (+)
G34322 NA non-coding upstream 590 16448846 ~ 16449090 (+)
G34297 NA non-coding upstream 140374 16301233 ~ 16309306 (+)
G34266 NA non-coding upstream 268831 16180508 ~ 16180849 (+)
G33830 NA non-coding upstream 288682 16158712 ~ 16160998 (+)
G34229 NA non-coding upstream 430191 16019263 ~ 16019489 (+)
G34330 NA non-coding downstream 16381 16472007 ~ 16472233 (+)
G34277 NA non-coding downstream 185716 16641342 ~ 16646222 (+)
G34357 NA non-coding downstream 209954 16665580 ~ 16672434 (+)
G34359 NA non-coding downstream 216918 16672544 ~ 16672767 (+)
G34361 NA non-coding downstream 218295 16673921 ~ 16674301 (+)
G33815 NA other upstream 383216 16063415 ~ 16066464 (+)
G34220 NA other upstream 509730 15939357 ~ 15939950 (+)
CI01000004_15091390_15096502 GA45B, GADD45B, GADD45BB other upstream 1357711 15091200 ~ 15097173 (+)
CI01000004_14036114_14036449 KIAA0040 other upstream 2412780 14035393 ~ 14039142 (+)
CI01000004_12646972_12652534 NA other upstream 3793969 12646838 ~ 12652570 (+)
G34400 NA other downstream 521702 16971995 ~ 17025976 (+)

Expression


Co-expression Network