G38068


Basic Information

Item Value
gene id G38068
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 3733130 ~ 3782702 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU43169
CGGAAAAACATTACATTCATTTCACACTTAATTATATTTAGAAAACACATTTTTTCTATAACAAGTACTCTTTTTAAAAGTATGTTAAGTGTACTTCTTGTTCGCAATGGAAGGGCGGGGGGTTACCTGAAGTGTGGATTCATTGCAGAGCTCGCGTCCAGCAAAGATGACCCGCAGTTGATCAGGCTGTACGCCCTGTAAACGCCCCACCGTCTTCTTCAGCTCTGCTATACTTGCACCCTTTTCCAATTCCACTGGGAACCCATGGCTGGAATTAAACCGCACATACACGATCATGCTGTGATATCTGTTACAGCCCAGACTCACTCCAGTGTGTGACTTTGGTGTTTGTTGACAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU43169 True 358 lncRNA 0.54 2 3733130 3782702

Neighbor

gene id symbol gene type direction distance location
CI01000005_03714714_03715575 NA coding downstream 17489 3714273 ~ 3715641 (-)
CI01000005_03530548_03573901 NA coding downstream 158349 3530249 ~ 3574781 (-)
CI01000005_03494256_03497235 QKI coding downstream 234113 3494077 ~ 3499017 (-)
CI01000005_03439939_03442430 NA coding downstream 289937 3439939 ~ 3443193 (-)
CI01000005_03412228_03417948 YIPF3, YIPF3.L coding downstream 314473 3412003 ~ 3418657 (-)
CI01000005_03986570_03989555 PRPH2B coding upstream 203397 3986099 ~ 3989555 (-)
CI01000005_04161239_04162612 NA coding upstream 378270 4160972 ~ 4163246 (-)
CI01000005_04296779_04299727 NA coding upstream 513936 4296209 ~ 4299810 (-)
CI01000005_04332499_04357527 XPO5 coding upstream 549788 4332490 ~ 4358857 (-)
CI01000005_04401277_04428207 NA coding upstream 618546 4401248 ~ 4428207 (-)
G38060 NA non-coding downstream 9322 3709093 ~ 3723808 (-)
G38050 NA non-coding downstream 57633 3675185 ~ 3675497 (-)
G37911 NA non-coding downstream 190153 3483651 ~ 3542977 (-)
G37913 NA non-coding downstream 213102 3476077 ~ 3520028 (-)
G38005 NA non-coding downstream 264976 3467681 ~ 3468154 (-)
G38136 NA non-coding upstream 61774 3844476 ~ 3849365 (-)
G38184 NA non-coding upstream 161344 3944046 ~ 3955218 (-)
G38183 NA non-coding upstream 177343 3960045 ~ 3980625 (-)
G38212 NA non-coding upstream 244031 4026733 ~ 4026948 (-)
G38223 NA non-coding upstream 270792 4053494 ~ 4053810 (-)
CI01000005_01883894_01899867 NA other downstream 1843854 1883222 ~ 1899867 (-)
G36628 NA other downstream 2068851 1663267 ~ 1664279 (-)
G36049 NA other downstream 2689458 1021295 ~ 1043672 (-)
G38510 NA other upstream 422143 4204845 ~ 4206208 (-)
G38415 NA other upstream 598536 4381238 ~ 4401110 (-)
G39515 NA other upstream 2051090 5833792 ~ 5834539 (-)
CI01000005_06481721_06483251 NA other upstream 2697987 6481355 ~ 6483265 (-)
G40487 NA other upstream 3413093 7195795 ~ 7196428 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_006379 prkn coding NC_007124.7 CM002897.2 3354895 ~ 3516473 (-)