G40101


Basic Information

Item Value
gene id G40101
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 7430106 ~ 7430335 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU45446
CTAGCATTAATTCGATCTCAAACCAATTCATCCACCACCTGCATGAAAAAATTTGCGACAATACGGTTTCAGGAAACAGTCGTGACCGGCTAATTTTTTCAACGATATCGTATACTGTATGGTAGTGAAGCAGCGAGTTATGTCGTTGTACGGCACCCCAGAAGAGCTGATGAACTCAGAGCCAGGAGAAGATAACCATAATTAGAAGTGACTTCTAGAGCCAGTGATCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU45446 True 230 lncRNA 0.43 1 7430106 7430335

Neighbor

gene id symbol gene type direction distance location
CI01000005_07402067_07403893 NA coding upstream 26213 7401811 ~ 7403893 (+)
CI01000005_07384171_07397440 NA coding upstream 32423 7383741 ~ 7397683 (+)
CI01000005_07368883_07371354 NA coding upstream 58052 7368883 ~ 7372054 (+)
CI01000005_07337613_07348597 DDX21 coding upstream 81509 7337613 ~ 7348597 (+)
CI01000005_07330665_07337161 NA coding upstream 92945 7330665 ~ 7337161 (+)
CI01000005_07447222_07447972 NA coding downstream 15665 7446000 ~ 7448298 (+)
CI01000005_07452398_07471837 NA coding downstream 22063 7452398 ~ 7472606 (+)
CI01000005_07474381_07477140 CFAP36 coding downstream 44046 7474381 ~ 7477688 (+)
CI01000005_07500131_07513279 PNPT1 coding downstream 66730 7497065 ~ 7513309 (+)
CI01000005_07516913_07529647 PPP4R3B coding downstream 86338 7516673 ~ 7529647 (+)
G40085 NA non-coding upstream 63235 7366611 ~ 7366871 (+)
G40083 NA non-coding upstream 64555 7365270 ~ 7365551 (+)
G40082 NA non-coding upstream 64900 7364986 ~ 7365206 (+)
G40081 NA non-coding upstream 67181 7362513 ~ 7362925 (+)
G40079 NA non-coding upstream 103246 7326659 ~ 7326860 (+)
G40131 NA non-coding downstream 177216 7607551 ~ 7607896 (+)
G40135 NA non-coding downstream 182590 7612925 ~ 7613174 (+)
G40137 NA non-coding downstream 185196 7615531 ~ 7615915 (+)
G39930 NA other upstream 431766 6997544 ~ 6998340 (+)
CI01000005_04735429_04736817 COX20 other upstream 2693249 4735346 ~ 4737082 (+)
G37392 NA other upstream 3706603 3722744 ~ 3723503 (+)
G36291 NA other upstream 5769074 1659733 ~ 1661032 (+)
G36223 NA other upstream 5892302 1503143 ~ 1537804 (+)
CI01000005_07600541_07600974 NA other downstream 167654 7600541 ~ 7602964 (+)

Expression


Co-expression Network