CI01000006_03737857_03742809 (GNG4, GNG2, GNG3)


Basic Information

Item Value
gene id CI01000006_03737857_03742809
gene name GNG4, GNG2, GNG3
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 3736572 ~ 3742820 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000006_03737857_03742809.mRNA
ACTGAGTCAAAATGGTGCCACAGTACAAGACAAAGAGGCTGAGACTGCAGCAGTTCCCATGGATGAAAGGAGACACCCCTGTGAACAGCACCATGAGCGTCGGTCAGGCTAGGAAGCTGGTGGAACAGCTGAAGATTGAAGCCAGTTTTTGTCGAATCAAGGTGTCTAAAGCAGCGGCAGACTTGATGGCCTACTGTGATGCCCATGCATGCGAGGACCCTCTCATCACCCCTGTGCCCACTTCAGAAAACCCATTCAGGGAGAAAAAGTTCTTCTGTGCTCTCCTCTGAGCAGGACACAGGAAGGGCAGGATTAGTCTCATTTAAATAATAATGATCATTTGTGTACGCACATCACACAACACAACACTCGACGAGACACGACACAGCAAAATAAA

Function

symbol description
gng3 Predicted to enable G-protein beta-subunit binding activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to act upstream of or within signal transduction. Predicted to be located in plasma membrane. Predicted to be part of heterotrimeric G-protein complex. Is expressed in nervous system and trigeminal placode. Orthologous to human GNG3 (G protein subunit gamma 3).
gng2 Predicted to enable G-protein beta-subunit binding activity. Acts upstream of or within sprouting angiogenesis and vascular endothelial growth factor receptor signaling pathway. Located in cytosol and membrane. Is expressed in cardiovascular system and nervous system. Orthologous to human GNG2 (G protein subunit gamma 2).
gng4 Predicted to enable G-protein beta-subunit binding activity. Involved in negative regulation of cell growth. Located in extracellular exosome.

GO:

id name namespace
GO:0031681 G-protein beta-subunit binding molecular_function

KEGG:

id description
K04540 GNG3; guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-3

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000006_03737857_03742809.mRNA False 397 mRNA 0.49 3 3737750 3742820

Neighbor

gene id symbol gene type direction distance location
CI01000006_03721474_03728658 NA coding downstream 8201 3719987 ~ 3729549 (-)
CI01000006_03631937_03713404 PC, PCX, PCXB, PCXA coding downstream 24346 3631937 ~ 3713404 (-)
CI01000006_03571836_03607035 PC coding downstream 130603 3571408 ~ 3607147 (-)
CI01000006_03555987_03560997 FKBP2 coding downstream 176753 3555641 ~ 3560997 (-)
CI01000006_03451569_03452222 BADA coding downstream 284284 3451386 ~ 3453466 (-)
CI01000006_03771304_03775923 NA coding upstream 28204 3771024 ~ 3776132 (-)
CI01000006_03782744_03792823 ESRRA coding upstream 39879 3782699 ~ 3793284 (-)
CI01000006_03814498_03821222 NA coding upstream 71613 3814433 ~ 3821222 (-)
CI01000006_03841667_03847765 STX5AL, STX5 coding upstream 98501 3841321 ~ 3847765 (-)
CI01000006_03850934_03852259 NA coding upstream 108114 3850934 ~ 3852304 (-)
G43339 NA non-coding downstream 200534 3536955 ~ 3537216 (-)
G43338 NA non-coding downstream 201424 3536048 ~ 3536326 (-)
G43337 NA non-coding downstream 202417 3534971 ~ 3535333 (-)
G43336 NA non-coding downstream 203629 3533528 ~ 3534121 (-)
G43335 NA non-coding downstream 206311 3529329 ~ 3531439 (-)
G43360 NA non-coding upstream 33401 3776221 ~ 3776452 (-)
G43368 NA non-coding upstream 63816 3806636 ~ 3806849 (-)
G43378 NA non-coding upstream 118661 3861481 ~ 3861708 (-)
G43377 NA non-coding upstream 119225 3862045 ~ 3862514 (-)
G43379 NA non-coding upstream 120293 3863113 ~ 3863338 (-)
G43102 NA other downstream 803766 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 1111564 2624436 ~ 2626776 (-)
G42934 NA other downstream 1155544 2523776 ~ 2582206 (-)
CI01000006_02285649_02294759 NA other downstream 1442752 2284994 ~ 2296494 (-)
G42667 NA other downstream 1846994 1888988 ~ 1890756 (-)
G43549 NA other upstream 609690 4352510 ~ 4355428 (-)
CI01000006_04560607_04560993 NA other upstream 816689 4559509 ~ 4562068 (-)
CI01000006_06974359_06976736 NA other upstream 3230404 6973224 ~ 6976872 (-)
CI01000006_07500281_07507754 NA other upstream 3760325 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 6740036 10453613 ~ 10484006 (-)

Expression


Co-expression Network